Активация роста волос: Советы профессионалов ALERANA по уходу за волосами

Содержание

Как ускорить рост волос? | Способы активации роста волос в СМ-Косметология

Многие женщины в процессе гонки за модными трендами экспериментируют над своими волосами, нанося им вред. Волосы становятся ломкими, выпадают и медленно отрастают, а каждой женщине хочется иметь роскошную прическу.

Почему медленно растут волосы?

Замедленный рост волос может быть следствием нарушения обмена веществ, недостатка витаминов и микроэлементов, среди которых особенно важными являются витамины группы В, сера, цинк, медь, йод, железо.

За неделю и даже за месяц невозможно вернуть былую длину, но ускорить процесс можно с помощью активаторов роста волос.

Что такое активаторы роста?

В арсенале каждой женщины есть проверенные методы укрепления и усиления роста волос. В основе средств, активирующих рост, лежит свойство «будить» спящие фолликулы волос. В результате локоны становятся гуще и быстрее растут. Помогают в этом различные маски на основе масел, настои и отвары лекарственных трав. Очень часто используется репейное масло, которое хорошо насыщает кожу головы и волосы витаминами.

Однако домашние средства далеко не идеальны и основной их недостаток заключается в том, что кудри остаются жирными, а при использовании некоторых рецептов еще и имеют неприятный запах. Поэтому большинство женщин используют косметические средства, которые далеко не всегда дают нужный результат. Все это приводит к тому, что вопрос, как можно быстрее отрастить собственные здоровые локоны, остается актуальным для прекрасной половины человечества.

Индивидуальная консультация

Активировать рост волос – простые решения

Профессиональные косметологи клиники «СМ-Косметология» в Москве с помощью новейших технологий и оборудования успешно решают проблему медленного роста волос. В арсенале наших специалистов необходимые препараты и сыворотки для активации спящих волосяных луковиц.

Центр современной косметологии и эстетической хирургии «СМ-Косметология» предлагает следующие процедуры для решения данной проблемы:

В нашей клинике «СМ-Косметология» благодаря индивидуальному подходу проблема каждого пациента решается быстро на высоком профессиональном уровне. Специалисты центра проводят комплексную оценку состояния кожи головы и волос и, исходя из полученных результатов обследования, подбирают методы лечения. При необходимости пациента направляют на консультацию к другим специалистам: врачу-диетологу, гомеопату, косметологу и дерматологу.

Опытные врачи с помощью современного оборудования точно поставят диагноз и определят причину заболевания.

В разделе «цены» указан полный перечень проводимых процедур и их стоимость. Однако следует учитывать, что окончательная цена лечения станет известна только после проведенного обследования и подбора эффективного метода терапии врачами клиники.


Записаться на прием

Официальный сайт Natura Siberica


СПА УХОД ДЛЯ ВОЛОС И КОЖИ ГОЛОВЫ «АКТИВАТОР РОСТА» oт HOME SPA by Natura Siberica и Полина Мечковская — это многоступенчатая программа направленная на по активацию роста волос их укрепление . Инновационные разработки и мощнейший потенциал сибирских трав и растений гарантируют превосходный видимый результат уже через 21 день использования.

Что вас ждет?

💙 Крепкие и сильные волосы
💙 Активный рост
💙 Экономия времени и средств на дорогостоящие процедуры
💙 5 шагов ухода
💙 4 сыворотки-концентрата, которые вы добавляете сами, чтобы достигать нужных целей
💙 Эффективный SPA-уход дома

ШАГ 1: Нанеси на кожу головы активизирующий пилинг.
ШАГ 2: Нанеси теплую маску наполни волосы силой и энергией.
ШАГ 3: Помой голову шампунем-активатором.
ШАГ 4: Нанеси маску-обёртывание для восстановления блеска и красоты каждого волоса.

ШАГ 5: Нанеси завершающий освежающий спрей.

Добавляй Сыворотки-концентраты в каждое средство, для получения максимального эффекта.

Совет 1: Используй масло Амлы для восстановления, и укрепления волосяных луковиц.
Совет 2: Разотрите и согрейте в ладонях масло виноградной косточки, нанести на секущиеся концы, масло, не утяжеляя волосы, быстро вернет красоту.
Совет 3: при использовании масел надень шапочку для душа, обмотай голову полотенцем и оставь на всю ночь, тепловой эффект усилит действие питательных веществ.
Совет 4: Для активации роста волос, смешай пару капель эфирного масла розмарина с любым базовым растительным маслом, нанести активными массажными движениями на проблемные участки.
Совет 5: Тщательно расчесывай волосы перед каждым мытьем головы.
Совет 6: Ополаскивай волосы холодной водой, волосы станут более ровными. Процедура способствует стимуляции кровеносных сосудов, питающих волосяные луковицы.

Что такое активатор роста волос

Густая шевелюра роскошно сверкающих при дневном свете волос - мечта каждой представительницы слабого пола с самого детства! Те из нас, кто не обладает таким природным богатством, только молча, грустят вслед тем красоткам, кому наследственность подарила настолько шикарные волосы.

Густая шевелюра роскошно сверкающих при дневном свете волос - мечта каждой представительницы слабого пола с самого детства! Те из нас, кто не обладает таким природным богатством, только молча, грустят вслед тем красоткам, кому наследственность подарила настолько шикарные волосы.

Однако не все так грустно, как может казаться. Бесспорно, мы не заказываем гены в магазине, но наш труд по улучшению того, что Бог дал, тоже не пропадает даром. Наряду с дорогими и эффективными лосьонами мы можем видеть на полках самый настоящий активатор роста волос, отзывы о чудодейственном воздействии которого, говорят восторженно и красноречиво. И причем, их сегодня большое множество.

Само по себе понятие активатора - не что иное, как косметическое средство по уходу за волосами, которое обладает свойством ускорять рост волос. При этом речь не идет о каких-то гормональных и прочих компонентах, которые в большей степени могут навредить, нежели помочь. Это, по большей части, компоненты натуральные, которые получены из растительных экстрактов и питательных масел. Поэтому если вы видите на полке магазина шампунь активатор роста волос, это значит, что в составе есть природный стимулятор, который заставит ваши волосы расти более интенсивно.

Причин, чтобы приобрести данные средства по уходу за волосами, может быть несколько. В худшем случае это - заболевание кожи головы и волосяных фолликул, что ведет к частичному облысению, а в лучшем (и такое часто бывает) - это просто замедление роста волос. Вроде они не выпадают, но и как-то не растут, как положено. Возможно, это - стресс, гормональный дисбаланс или еще что-то в этом роде, но в данной ситуации уж точно не помешает шампунь активатор роста.

Разновидности активаторов


  • Шампунь активатор. За счет активных гранул в своем составе они стимулируют приток крови к голове, поэтому волосы начинают активный рост.
  • Косметические масла. Используются в виде компрессов или в составе масок.
  • Маски активаторы. Проникают в более глубокие слои кожи, обволакивают фолликулы волос и за счет лечебного воздействия их компонентов, а также за счет защиты от пагубного внешнего воздействия, они восстанавливают природный рост волос.
  • Капсулы. Их состав - настоящий витаминный коктейль для волоса. Их втирают или вводят в качестве подкожных инъекций (только опытным специалистом косметологом).

Что же входит в состав


Это - традиционные витамины группы В и Е. Без них, как правило, не бывает никакого здоровья у наших волос. Они не только способствуют росту волос, но и их укреплению и красивому внешнему виду. Также часто в качестве активатора добавляют настойку красного перца, действие которого очень простое - внешнее раздражение кожи головы и, как следствие, интенсивный приток крови. По этому же принципу действуют и другие компоненты, действие которых можно ощутить как "пощипывание" и "покалывание". Экстракты ромашки, крапивы, коры дуба, каштана - тоже неплохо справляются с этой задачей.

Эффективно также действуют на ускорение процесса роста и микроэлементы, входящие в шампунь активатор роста волос - отзывы пользователей не раз упоминали цинк, кремний и медь.

Еще одним фактором успеха является последовательность и решимость. Не стоит ждать, что чудо свершится уже "к утру". Проявите настойчивость и не бойтесь экспериментов. Главное, чтобы у вас не было аллергической реакции на какой-либо природный компонент.

Активный лосьон для стимуляции роста волос 100 мл Time To Grow

Состав:

Deionized water, phospholipids, sphingolipids, panthenyl ethyl ether, milk protein, lactose, inositol, acetyl cysteine, acetyl methionine, sodium citrate, polysorbate 20, glycerin, Serenoa serrulata fruit extract, creatine, niacinamide, methylsulfonylmethane, pinanediol, camphanediol, 1. 3-butylene glycol, hydrolyzed milk protein, adenoside triphosphate, dipotassium glycyrrhizinate, niacinamide, calcium pantothenate, sodium ascorbyl phosphate, tocopheryl acetate, pyridoxine HCl, maltodextrin, silica, sodium starch octenylsuccinate, lecithin, Camellia sinensis L., microcrystalline cellulose, quaternium-22, polyglyceryl-3 caprate, cocamidopropyl betaine, menthol, o-cymen-5-ol, parfume, аscorbic acid, citric acid, glycolipids, glycerin, bioflavonoids.

 

Базовая основа-носитель: сфинголипиды и пантенол

Ядро активности: два уникальных запатентованных ингредиента:

  1. Запатентованный комплекс бициклических монотерпеновых диолов «Пинадиол+камфанедиол»— инициируют фибробласты дермальной папиллы фолликула к возобновлению роста волос из «спящих» фолликулов, продлевают фазу роста. Комплекс в 3 раза увеличивает генерацию оксида азота на 24 часа: вазодилатация, усиление микроциркуляции, активация роста волос, противо-воспалительное действие (пр-во США, действие доказано in vivo и in vitro).
  2. Комплекс сигнальных молекул из натуральных пептидов стимулируют рост и утолщение волос (пр-во Германия, действие доказано in vivo и in vitro).

Вторая линия активности: комплекс метаболиков, адаптогенов, анти-андрогенов, противовоспалительных вещества, антиоксидантов, ангио- и нейропротекторов адаптирует фолликулы и кожу к нагрузкам, интоксикациям (соматические проблемы, стресс, агрессивный стайлинг, инфекции и пр)

Подробнее о базовой основе -носителе:

  • Активные ингредиенты растворены не в спирте и пропиленгликоле (их нет в составе Активного лосьона), а в пантеноле и сфинголипидах.
  • Пантенол - известный противо-воспалительный ингредиент (витамин В5). Является необходимым коферментом базовых биохимических реакций ацетилирования и окисления, синтезе ацетилхолина (нервный проводник). Уменьшает реакции воспаления, в том числе в нервных волокнах, уменьшает явления аллергии и интоксикации, ускоряет регенерацию.
  • Сфинголипиды - идентичные натуральным вещества, входящие в естественную структуру клеточных мембран и внутренних структур клеток. Сфинголипиды- класс молекул, имеющих общее структурное основание-сфингозин. Сфинголипиды являются регуляторными молекулами, обнаружены во всех типах клеток, поддерживают структуру и функциональную активность плазматической мембраны, ядра и всех органелл. Регулируют процессы роста и развития клеток, адекватного восприятия клеткой внешних сигналов. Являются естественными иммуномодуляторами. Имеют противо-опухолевое действие.

Подробнее о свойствах активных ингредиентов:

Серосодержащие аминокислоты — ацетилцистеин + ацетилметионинCубстрат для синтеза крепкого и здорового стержня, основа структуры волоса.
Кальция пантотенат, натрия аскорбил фосфат, токоферола ацетат, пиридоксинВитамины, ключевые регуляторы метаболизма фолликула, швейцарский запатентованный комплекс с высокой степенью взаимной совместимости.
Ниацинамид + креатин + АТФУсиливают энергетический потенциал, клеточное дыхание и нормализуют митохондриальную функцию, тем самым усиливая способность клеток волосяных луковиц противостоять избыточным нагрузкам, интоксикациям, способствуя возобновлению роста волос из неактивных фолликулов.
Экстракт карликовой пальмы, экстракт зеленого чая (Камелия синензис) и цинкИнгибирование [email protected] редуктазы, уменьшение влияния андрогенов на фолликул, противовоспалительное действие.
Этинилпантенол (провитамин В5 ) + инозитолНейропротекторное, противовоспалительное действие.
Пинадиол + камфанедиолВ 3 раза увеличивает генерацию оксида азота на 24 часа: вазодилатация, усиление микроциркуляции, активация фибробластов дермальной папиллы фолликула.
Сигнальные молекулы из натуральных пептидовПролонгация анагена, стимуляция анагена в кеногеновых фолликулах.
Дикалия глицирризинатКомплексное противовоспалительное действие.
Фитосомы зеленого чаяАнтиоксидантное, онкопротекторное, anti-age действие.
Сфинголипиды, заключенные в фосфолипиды (керамиды 3; керамиды -6 II; керамиды 1, фитосфингозин; холестерол)Восстановление защитных свойств липидной мантии, регуляция кератинизации, регуляция качества синтеза стержня. Противовоспалительное, успокаивающее и регенерирующее действие.

как выбрать стимулятор роста темных и светлых волос? Отзывы профессионалов

Средства для волос

Идя по улице, занимаясь своими делами, сидя в кафе, мы рассматриваем окружающих нас людей, подмечая различные мелочи. Чаще всего это происходит неосознанно, но детали чётко воспринимаются и анализируются нами. Будь то одежда, макияж у женщин, обувь или причёска. Получается, что выглядеть хорошо — очень важно.

Одним из факторов, которые позволяют этого добиться, является причёска или просто красивые волосы. Но ведь не всех природа одарила пышной шевелюрой! Что же делать тем, у кого на голове нет шикарных локонов, а парик носить не хочется?

Активаторы роста волос – что это?

Активаторами или стимуляторами роста называют различные вещества, способные влиять на процесс роста волос в сторону его ускорения. Они имеют различные формы – мази, крема, маски, лосьоны, тоники, ампулы, растворы, спреи, бальзамы и так далее. А также разное происхождение – на основе натуральных компонентов и синтезированные в лаборатории.

Такие средства можно приобрести в аптеках, магазинах бытовой химии либо приготовить самостоятельно в домашних условиях.

Какой эффект можно ждать при регулярном применении

Покупая какое-либо из подобных средств, мы рассчитываем на быстрый эффект от усилителя. Однако нужно запастись терпением и регулярно их применять. В таком случае результат не заставит себя ждать и будет стоить потраченных усилий. Но чаще всего, кроме увеличения длины, можно получить и дополнительные «бонусы»:

  • питание волосяного стержня и луковиц витаминами, восполнение их нехватки и предотвращение избыточной потери питательных веществ;
  • снижают выраженность перхоти, предотвращают её дальнейшее появление, также облегчают проявления многих кожных заболеваний, уменьшая активность патогенных микроорганизмов;
  • замедляют выпадение волос, пробуждают «спящие» луковицы, увеличивая густоту шевелюры;
  • улучшают состояние волосяного стержня по всей длине;
  • облегчают манипуляции – расчёсывание, укладку;
  • защищают при сушке феном.

Полезные вещества в составе

Для того чтобы активаторы давали результаты, например, мощный рост волос, в их составе должен быть коктейль из полезных элементов. В качестве «кирпичиков» можно считать:

  • натуральные масла – облепиховое, льняное, репейное или аргановое;
  • экстракты или вытяжки из лекарственных растений, оказывающих стимулирующее действие на обменные процессы – алоэ, перец, хмель, крапива, чеснок, лук;
  • минеральные соединения и витамины;
  • структурные соединения, близкие по составу с волосяными, служащие для восстановления стержня после различных манипуляций – кератин, белки.

Положительным моментом является то, что активаторы роста волос для женщин практически универсальны, то есть подходят различным типам волос – сухим, нормальным, жирным, секущимся. Также они просты в применении, доступны – средства можно найти в магазинах, а также можно подобрать себе продукт в зависимости от стоимости.

Представители стимуляторов роста волос

Среди активаторов в виде шампуней лучшими стимуляторами называют такие продукты: «Виши», «Алерана», «Селен+», «Кора», «Белуга». Такие шампуни, как правило, используются с лечебной целью по назначению врача. И направлены на решение одной проблемы.

Эффективны, продаются преимущественно в аптеках. Можно действие усиливать народными средствами.

Лосьоны-стимуляторы представлены такими средствами: «Эксидем», «Гарньер», «Медикомед», «Кашемир», «ДНС». В их составе содержатся витамины группы В, минеральные соединения, средства для расширения сосудов. Такие активаторы способны «жирнить» волосы и кожу.

Группу тоников представляют: «Белита-витекс», «Эксперт-нео», «Кора» и другие.

Также активаторы могут быть в виде масок (горячих и холодных), таблеток, витаминных комплексов, сывороток.

Отдельное место занимают народные средства. Чаще всего их рекомендуют применять, как вспомогательный метод. Могут использоваться такие продукты: перец, календула, лук, крапива, чеснок, яйцо, уксус, масла. Из них делают маски, компрессы, ополаскивающие средства.

Отзывы от потребителей и профессионалов

Отзывы пользователей.

Пользователи продукта DNC отмечают его положительные моменты – низкая стоимость, эффективность, сохранность результата. Они довольны средством и считают его одним из лучших стимуляторов, подходящим как для профилактики, так и для решения проблем с волосами.

При опросе о средствах продукции марки «Эстель», включая шампуни, кондиционеры, стимуляторы для волос, пользователи отмечают, что при изменении причёски или цвета (например, с тёмных на светлые), можно за несколько месяцев вернуть необходимую длину. Довольны результатом и рекомендуют фирму другим.

Что говорят покупатели о средстве Energizer? Минусом является то, что оно производится в США и приобрести его можно только путём заказа, а это долгая доставка товара. То есть если баночка скоро закончится, может произойти нежелательный перерыв в пользовании. Однако несомненным преимуществом является быстрый рост волос, их здоровый и красивый внешний вид. После того как курс завершается, эффект исчезает. Волосы растут намного медленнее. Однако, в общем, пользователи довольны этим средством.

Пользователи, тестировавшие продукт «Алерана», отмечают положительный результат, однако, высокую стоимость средства.

Мнение профессионалов и производителей.

Большинство профессионалов сходится на том, что стимуляторы роста волос могут применяться как лечебные средства и в качестве профилактики проблем с волосами. Также если вы собираетесь использовать активатор, для начала желательно проконсультироваться с врачом-трихологом, дерматологом или терапевтом, чтобы выяснить и устранить первопричину проблемы, а затем использовать средство. Также нужно убедиться в том, что вы правильно применяете его.

Средство «Эстель Отиум», по словам производителей, очень эффективно стимулирует волосяные луковицы, в том числе и «спящие», что способствует повышению густоты волос.

А также за месяц применения они вырастут на 5 см, благодаря пантенолу, молочной кислоте и протеинам, входящим в его состав.

«Медикомед»: позволяет отрастить волосы на 5 см в месяц. Отлично подходит для использования в домашних условиях, не требует смывания.

«Тинде»: активатор-шампунь на основе натурального сырья, как заявляют китайские производители. Подходит для тёмных, светлых, повреждённых и окрашенных волос. При использовании может возникать незначительное покалывание кожи головы — это означает, что средство оригинальное и действует.

Однако при значительном жжении следует быстро смыть его большим количеством воды и обратиться к врачу.

«Алерана»: подходит для использования как женщинам, так и мужчинам. Отпускается в аптеках. Высоко эффективен и в своём составе содержит большое число витаминов. Может применяться также для лечения облысения и выпадения волос.

«Кера-нова»: средство эффективно как профилактическое при выпадении волос, также при наличии этой проблемы борется с ней, стимулирует рост волос до 4 см в месяц, улучшает состояние волосяного стержня и кожи головы, что приводит к уменьшению перхоти.

Содержит перец, поэтому при использовании нужно быть готовым к жжению.

«Эксидерм»: выпускается в виде эмульсии. В составе заявлены ионы серебра, что положительно сказывается на состоянии кожи, средство способствует уничтожению болезнетворных микроорганизмов. Разрешён к ежедневному применению. Рост стимулирует незначительно – до 3 см в месяц.

«Золотой Шёлк»: средство в виде шампуня. Делает волосы шелковистыми и блестящими внешне, а также здоровыми внутри. Однако именно активация роста не сильно выражена. Действие больше направлено на оздоровление волос и кожи головы.

«Ниоксин интенсив»: содержит никотиновую кислоту. Производители заявляют, что результат заметен даже после первой процедуры. Может вызывать аллергическую реакцию. Мощный активатор роста волос, также улучшает их внешний вид.

«Флоресан»: представлен в виде маски для волос. Является довольно бюджетным средством.

Борется с лёгкой степенью выпадения волос, стимулирует рост.

«Эстель Бьюти»: выпущен в виде спрея для волос. Придаёт локонам блестящий и живой вид. Содержит большое количество витаминов, белка, различных экстрактов. Лечит волосы от повреждений и защищает от новых. Активирует «спящие» луковицы.

«Лактимик»: содержит молочную кислоту. Это позволяет защищать волосы от негативного действия факторов окружающей среды (ветра, солнца), мощно стимулирует рост волос.

Обзор активатора роста волос смотрите в следующем видео.

Эксидерм активатор роста волос 200мл Королевфарм ооо в Казани

Выберите районАвиастроительныйАзиноАзино-2ВахитовскийДербышкиКварталКировскийМосковскийПриволжскийСоветскийЦентрЮдиноКировский, ЮдиноНово-СавиновскийСоветский, ДербышкиСоветский, ЖК ВеснаСоветский, Константиновка

Выберите аптекуул.Фучика;д.82ул.Достоевского;д.53ул.Закиева;д.5ул.Галии Кайбицкой;д.3ул.Чистопольская;д.71, корп.Аул.Гарифа Ахунова;д.2ул.Гаврилова;д.40/2ул.Чистопольская;д.38ул.Юлиуса Фучика;д.64, корп.1ул.Карла Маркса;д.29/14 литер Бул.Кремлевская;д.23/17ул.Восстания;д.56ул.Нурсултана Назарбаева;д.21/64ул.Восстания;д.43ул.Карла Маркса;д.46ул.Ибрагимова проспект;д.19ул.Фрунзе;д.17ул.Татарстан;д.52ул.Победы проспект;д.152/33ул.Академика Парина;д. 6ул.Кулахметова;д.25, к.2ул.Сибирский тракт;д.8пр-кт Хусаина Ямашева;д.91ул.Николая Ершова;д.56ул.Достоевского;д.66ул.Парковая;д.6ул.Ленинградская;д.22ул.Фатыха Амирхана;д.71ул.Гвардейская;д.2/22ул.Белинского;д.5ул.Нурсултана Назарбаева;д.45ул.Горьковское шоссе;д.33ул.Копылова;д.18ул.Декабристов;д.117ул.Космонавтов;д.16ул.Академика Губкина;д.44ул.Волгоградская;д.1ул.Ломжинская;д.17ул.Мусина;д.68 Аул.Юлиуса Фучика;д.108ул.Дубравная;д.47ул.Академика Лаврентьева;д.22ул.Галии Кайбицкой;д.12ул.А.Глушко;д.16 Бул.Четаева;д.58 Бпр-кт Хусаина Ямашева;д.46/33пр-кт Победы;д.34ул.Мамадышский тракт;д.32пр-д.Оренбургский;д.138 Жул.Рихарда Зорге;д.58 Аул.Лейтенанта Красикова;д.5/34ул.Лейтенанта Красикова;д.8ул.Карбышева;д.12 Аул.Шмидта;д.8пр-кт Ямашева;д.17ул.Фатыха Амирхана;д.41 Аул.Баки Урманче;д.8ул.Чистопольская;д.11ул.Карбышева;д.48ул.Айдаров;д.8 Аул.Юлиуса Фучика;д.131пр-кт Ибрагимова;д.56ул.Мавлютова;д.45ул.Латышских Стрелков;д.4ул.Максимова;д.27ул.Батыршина;д.20 Аул.Голубятникова;д.5ул.Клары Цеткин, в/д;д. 17ул.Рихарда Зорге;д.11 Бул.Хади Такташа;д.73ул.Кул Гали;д.32ул.Максимова;д.22/22ул.Сыртлановой;д.16ул.Рихарда Зорге;д.101ул.Аделя Кутуя;д.7ул.Сафиуллина;д.5ул.Зеленая; д.85пр-кт Ямашева; д.97Оренбургский тракт;д.170ул.Даурская; д.12ул.Рихарда Зорге;д.66 пом.3ул. Мусина;д.29Татарстан ул, дом № 52Азата Аббасова ул,10Павлюхина ул, д.91 КазаньМоллФучика ул,108Адоратского ул, д.27Р.Зорге ул, д.67 Разведчика Ахмерова, 5Баумана ул зд.49/10 Аптека ПроломнаяДекабристов ул, д.131Пушкина ул, д № 5/43Даурская ул, дом № 21/9Победы пр-кт, д.139к.2Адоратского ул, д.2БВосстания ул, д.92А

Возобновление роста волос. Активатор собственных стволовых клеток волосяных фолликул

 

Препараты «КРЕСЦИНА» (CRESCINA) являются результат научных исследований, начало которым было положено в 1991 году. Именно тогда первый базовый комплекс, состоящий из двух аминокислот и названный «КРЕСЦИНА», вошел в состав средства против выпадения волос, производимого компанией Labo.  

В настоящее время препаратами «КРЕСЦИНА» пользуются десятки и сотни тысяч людей, страдающие от выпадения волос. Согласно опросу, участие в котором приняли более 7 300 человек, использующих этот препарат, в 85% случаев потребители довольны результатами, полученными от его применения, а именно возобновлением роста волос.

 

Линейка «КРЕСЦИНА» состоит из серии продуктов со специальными формулами для мужчин и женщин.

 

 

 

Кресцина для возобновления роста волос / Crescina Re-Growth HFSC 100% — активатор собственных стволовых клеток волосяных фолликул. Состав защищен швейцарским патентом (всего 8 патентов): сочетание аминокислот цистеина и лизина (главных компонентов кератина волос) со специальным фактором роста гликопротеином и сосудорасширяющим ингредиентом, инкапсулированными в водно-спиртовой носитель. Многочисленные тесты на эффективность доказывают способность этого комплекса стимулировать естественный рост волос, действуя на активные или частично активные фолликулы. Другие компоненты, способствующие действию препарата: дигуанозин ТР (Diguanosine TP), Пролифекс (Protifex), Изофол (Isofol), салициловая кислота и ДНК, полученная методами биотехнологии. Препарат не оказывает воздействия на полностью атрофированные волосяные фолликулы.

Кресцина комплексное лечение для возобновления роста волос + против выпадения волос (Crescina Re-Growth HFSC 100% + Crescina Anti-Hair Loss HSSC) — препараты для местного применения, разработанные специально как для женщин, так и для мужчин.

Одна упаковка содержит флаконы двух типов:

  • Кресцина для возобновления роста волос (Crescina Re-Growth HFSC 100% — янтарные флаконы) содержит запатентованный комплекс Crescina Re-Growth (цистеин, лизин и гликопротеин), способствующий естественному росту волос. Часть запатентованных активных ингредиентов (цистеин, лизин, гликопротеин и Stem-Engine) инкапсулированы в специальные носители, обеспечивающие их постепенное и длительное высвобождение в коже волосистой части головы. Полноценное функционирование стволовых клеток, содержавшихся в волосяном фолликуле – основа роста новых волос.
  • Препарат против выпадения волос (Crescina Anti-Hair Loss HSSC — прозрачные флаконы) содержит основные активные ингредиенты (гидроксипролин, аспарагиновую кислоту, активатор ферментов и таурин), гидролизованный дрожжевой белок и ацетил тетрапептид-3, укрепляющие корни волос (тестирование активных ингредиентов in vitro). В состав препарата также входит комплекс HSSC, защищающий и поддерживающий здоровое состояние кожи головы (тестирование активных ингредиентов in vivo и in vitro). Препарат Crescina Anti-Hair Loss HSSC предназначен для предотвращения и коррекции выпадения волос, вызванного физиологическими, но не патологическими причинами.

нервных стволовых клеток восстанавливают рост волос за счет активации ниши волосяного фолликула

Некоторые типы выпадения волос возникают в результате неспособности волосяных фолликулов инициировать фазу анагена цикла регенерации волос. Модуляция сигнальных путей в нише волосяного фолликула может стимулировать вступление в фазу анагена. Несмотря на значительные усилия, методы лечения на основе стволовых клеток или фармакологии для активации ниши волосяных фолликулов не увенчались успехом.Здесь мы решили проверить влияние экстракта нервных стволовых клеток (NSC) на нишу волосяного фолликула на возобновление роста волос. Экстракты NSC наносили на иммортализованные клеточные линии HaCaT, кератиноциты и клетки дермального сосочка (DPC), а также на выбритую спинную кожу мышей. Лечение экстрактом NSC резко улучшило рост кератиноцитов HaCaT и DPC. Кроме того, экстракт NSC усиливал рост волос на бритой спинной части кожи мышей. Чтобы определить молекулярные пути передачи сигналов, регулируемые NSC, мы оценили уровни экспрессии нескольких факторов роста и передачи сигналов, таких как инсулиноподобный фактор роста-1 (IGF-1), фактор роста гепатоцитов (HGF), фактор роста кератиноцитов ( KGF), фактор роста эндотелия сосудов (VEGF), трансформирующий фактор роста-β (TGF-β) и члены семейства костных морфогенетических белков (BMP). Мы обнаружили, что лечение экстрактом NSC усиливает рост волос за счет активации ниш волосяных фолликулов посредством корегуляции сигнальных путей TGF-β и BMP в фазе телогена. Мы также наблюдали активацию и дифференцировку внутрифолликулярных стволовых клеток волосяных фолликулов, матричных клеток и экстрафолликулярных DPC in vivo и in vitro. Мы проверили, является ли активация путей фактора роста основным эффектом лечения НСК на рост волос путем нанесения факторов роста на кожу мыши. Комбинированные факторы роста, включая TGF-β, значительно увеличивали длину стержня волоса и скорость роста.Повреждение ДНК и гибель клеток не наблюдались в клетках кожи мышей, получавших экстракт NSC в течение длительного периода. В целом, наши данные демонстрируют, что экстракт NSC обеспечивает эффективный подход к стимулированию роста волос путем непосредственной регуляции ниш волосяных фолликулов посредством сигнальных путей TGF-β и BMP, а также индукции основных факторов роста.

стволовых клеток дают надежду на рост волос - журнал U - UCLA Health

Передний край

Иллюстрация: Maja Moden

Исследователи Калифорнийского университета в Лос-Анджелесе открыли новый способ активации стволовых клеток в волосяном фолликуле для роста волос. Исследование может привести к созданию новых лекарств, которые могут способствовать росту волос у людей с облысением или алопецией, то есть выпадением волос, связанным с такими факторами, как гормональный дисбаланс, стресс, старение или химиотерапия.

Исследователи Калифорнийского университета в Лос-Анджелесе открыли новый способ активации стволовых клеток в волосяном фолликуле для роста волос. Исследование может привести к созданию новых лекарств, которые могут способствовать росту волос у людей с облысением или алопецией, то есть выпадением волос, связанным с такими факторами, как гормональный дисбаланс, стресс, старение или химиотерапия.Стволовые клетки волосяного фолликула - это долгоживущие клетки волосяного фолликула, которые присутствуют в коже и производят волосы на протяжении всей жизни человека. Они неподвижны, то есть обычно неактивны, но они быстро активируются во время нового цикла волос, когда происходит рост новых волос. Покой стволовых клеток волосяного фолликула регулируется многими факторами. В некоторых случаях они не активируются, что вызывает выпадение волос.

Исследование, проведенное Хизер Кристофк, доктором философии, и Уильямом Лоури, доктором философии, из Центра регенеративной медицины и исследований стволовых клеток Эли и Эдит Брод при Калифорнийском университете в Лос-Анджелесе, показало, что метаболизм стволовых клеток волосяного фолликула отличается от метаболизма других клеток кожи.Клеточный метаболизм включает в себя расщепление питательных веществ, необходимых клеткам для деления, выработки энергии и реакции на окружающую среду. В процессе метаболизма используются ферменты, которые изменяют эти питательные вещества для производства метаболитов. Поскольку стволовые клетки волосяных фолликулов потребляют питательную глюкозу - форму сахара - из кровотока, они перерабатывают глюкозу с образованием метаболита, называемого пируватом. Затем клетки могут отправлять пируват в свои митохондрии - часть клетки, которая вырабатывает энергию - или преобразовывать пируват в другой метаболит, называемый лактатом.

Группа исследователей сначала генетически заблокировала производство лактата у мышей и показала, что это предотвращает активацию стволовых клеток волосяного фолликула. И наоборот, в сотрудничестве с лабораторией Раттера в Университете штата Юта они генетически увеличили выработку лактата у мышей, что ускорило активацию стволовых клеток волосяного фолликула, увеличивая цикл роста волос.

Команда определила два препарата, которые при нанесении на кожу мышей по-разному влияли на стволовые клетки волосяных фолликулов, способствуя выработке лактата.Первый препарат, называемый RCGD423, активирует клеточный сигнальный путь, называемый JAK-Stat, который передает информацию извне клетки в ядро ​​клетки. Исследование показало, что активация JAK-Stat приводит к увеличению выработки лактата, что, в свою очередь, приводит к активации стволовых клеток волосяных фолликулов и ускорению роста волос. Другой препарат под названием UK5099 блокирует проникновение пирувата в митохондрии, что вызывает выработку лактата в стволовых клетках волосяного фолликула и ускоряет рост волос у мышей.

«Активность лактатдегидрогеназы способствует активации стволовых клеток волосяного фолликула», Nature Cell Biology , 14 августа 2017 г.


Механическое растяжение вызывает регенерацию волос за счет альтернативной активации макрофагов

  • 1.

    Discher, DE, Mooney, DJ & Зандстра, П.В. Факторы роста, матрицы и силы объединяют и контролируют стволовые клетки. Наука 324 , 1673–1677 (2009).

    ADS CAS Статья Google ученый

  • 2.

    Гуо, К. Л., Харрис, Н. К., Виджератн, С. С., Фрей, Э. В. и Кианг, К. Х. Мультимасштабная механобиология: механика на молекулярном, клеточном и тканевом уровнях. Cell Biosci. 3 , 25 (2013).

    CAS Статья Google ученый

  • 3.

    Aragona, M. et al. Механическая контрольная точка контролирует многоклеточный рост посредством регулирования YAP / TAZ факторами процессинга актина. Ячейка 154 , 1047–1059 (2013).

    CAS Статья Google ученый

  • 4.

    Хуанг С. и Ингбер Д. Э. Структурная и механическая сложность контроля роста клеток. Nat. Cell Biol. 1 , E131 – E138 (1999).

    CAS Статья Google ученый

  • 5.

    Сасай, Ю. Цитосистемная динамика в самоорганизации тканевой архитектуры. Природа 493 , 318–326 (2013).

    ADS CAS Статья Google ученый

  • 6.

    Маммото Т. и Ингбер Д. Э. Механический контроль развития тканей и органов. Разработка 137 , 1407–1420 (2010).

    CAS Статья Google ученый

  • 7.

    Mammoto, T. et al. Механохимический контроль конденсации мезенхимы и формирования эмбриональных органов зуба. Dev.Ячейка 21 , 758–769 (2011).

    CAS Статья Google ученый

  • 8.

    Chen, C.C. et al. Чувствительность кворума на уровне органов направляет регенерацию популяций стволовых клеток волос. Ячейка 161 , 277–290 (2015).

    CAS Статья Google ученый

  • 9.

    Торкамани, Н., Руфау, Н. В., Джонс, Л. и Синклер, Р. Разрушение мышцы-ограничителя пилей и жировая инфильтрация при андрогенной алопеции. руб. J. Dermatol. 170 , 1291–1298 (2014).

    CAS Статья Google ученый

  • 10.

    Торкамани Н., Руфау Н. В., Джонс, Л. и Синклер, Р. Д. Помимо мурашек по коже: играет ли роль мышцы, сокращающей пили, в выпадении волос? Int J. Trichology 6 , 88–94 (2014).

    Артикул Google ученый

  • 11.

    Яздабади, А., Whiting, D., Rufaut, N. & Sinclair, R. Миниатюрные волосы поддерживают контакт с мышцами arrector pili при очаговой алопеции, но не при андрогенетической алопеции: модель обратимой миниатюризации и возможность повторного роста волос. Int J. Trichology 4 , 154–157 (2012).

    Артикул Google ученый

  • 12.

    Muller-Rover, S. et al. Исчерпывающее руководство для точной классификации волосяных фолликулов мыши на разных стадиях цикла роста волос. J. Invest. Дерматол. 117 , 3–15 (2001).

    CAS Статья Google ученый

  • 13.

    Чен К. и Чуонг С. М. Многослойная регуляция окружающей среды на гомеостаз стволовых клеток: сага о росте волос и облысении. J. Dermatol. Sci. 66 , 3–11 (2012).

    Артикул Google ученый

  • 14.

    Пликус, М.V. et al. Циклическая передача сигналов дермального BMP регулирует активацию стволовых клеток во время регенерации волос. Nature 451 , 340–344 (2008).

    ADS CAS Статья Google ученый

  • 15.

    Пликус, М. В., Виделиц, Р. Б., Максон, Р. и Чуонг, С. М. Анализ моделей регенеративных волн в популяциях волосяных фолликулов взрослых показывает макро-экологическую регуляцию активности стволовых клеток. Внутр. J. Dev. Биол. 53 , 857–868 (2009).

    Артикул Google ученый

  • 16.

    Чен, К. К., Пликус, М. В., Танг, П. К., Уайделиц, Р. Б. и Чуонг, С. М. Модулируемая ниша стволовых клеток: взаимодействие тканей во время регенерации волосяного и перьевого фолликулов. J. Mol. Биол. 428 , 1423–1440 (2016).

    CAS Статья Google ученый

  • 17.

    Greco, V. et al. Двухступенчатый механизм активации стволовых клеток во время регенерации волос. Стволовые клетки клетки 4 , 155–169 (2009).

    CAS Статья Google ученый

  • 18.

    Enshell-Seijffers, D., Lindon, C., Kashiwagi, M. & Morgan, B.A. Активность бета-катенина в дермальных сосочках регулирует морфогенез и регенерацию волос. Dev. Ячейка 18 , 633–642 (2010).

    CAS Статья Google ученый

  • 19.

    Lowry, W. E. et al. Определение влияния трансактивации бета-катенина / Tcf на эпителиальные стволовые клетки. Genes Dev. 19 , 1596–1611 (2005).

    CAS Статья Google ученый

  • 20.

    Демичева, Э., Хеккер, М. и Корфф, Т. Индуцированная растяжением активация белка-активатора фактора транскрипции-1 контролирует экспрессию хемоаттрактантного белка-1 моноцитов во время артериогенеза. Circ. Res. 103 , 477–484 (2008).

    CAS Статья Google ученый

  • 21.

    Gruden, G. et al. Механическое растяжение индуцирует хемоаттрактантную активность моноцитов через NF-kappaB-зависимый путь, опосредованный хемоаттрактантным белком-1 моноцитов в мезангиальных клетках человека: ингибирование розиглитазоном. J. Am. Soc. Нефрол. 16 , 688–696 (2005).

    CAS Статья Google ученый

  • 22.

    Боняковски, А. Е., Кимбалл, А. С., Якобс, Б. Н., Кункель, С. Л., Галлахер, К. А. Макрофагально-опосредованное воспаление при нормальном и диабетическом заживлении ран. J. Immunol. 199 , 17–24 (2017).

    CAS Статья Google ученый

  • 23.

    Миллс, К. Д. Макрофаги M1 и M2: оракулы здоровья и болезней. Crit. Rev. Immunol. 32 , 463–488 (2012).

    CAS Статья Google ученый

  • 24.

    Миллс, К. Д., Кинкейд, К., Альт, Дж. М., Хейлман, М. Дж. И Хилл, А. М. Макрофаги M-1 / M-2 и парадигма Th2 / Th3. J. Immunol. 164 , 6166–6173 (2000).

    CAS Статья Google ученый

  • 25.

    Миллс, К. Д. Анатомия открытия: макрофаги M1 и M2. Front Immunol. 6 , 212 (2015).

  • 26.

    Миллс, К. Д. и Лей, К. Макрофаги M1 и M2: курица и яйцо иммунитета. J. Врожденный иммунитет. 6 , 716–726 (2014).

    CAS Статья Google ученый

  • 27.

    Гордон С. Альтернативная активация макрофагов. Nat. Rev. Immunol. 3 , 23–35 (2003).

    CAS Статья Google ученый

  • 28.

    Кано, Ф., Мацубара, К., Уэда, М., Хиби, Х. и Ямамото, А. Синергетически секретируемый эктодомен связывающего сиаловую кислоту Ig-подобного лектина-9 и хемоаттрактантного белка-1 моноцитов регенерировать перерезанные периферические нервы крысы путем изменения полярности макрофагов. Стволовые клетки 35 , 641–653 (2017).

    CAS Статья Google ученый

  • 29.

    Das, A. et al. Пластичность моноцитов и макрофагов при восстановлении и регенерации тканей. Am. J. Pathol. 185 , 2596–2606 (2015).

    CAS Статья Google ученый

  • 30.

    Гордон С. и Мартинес Ф. О. Альтернативная активация макрофагов: механизм и функции. Иммунитет 32 , 593–604 (2010).

    CAS Статья Google ученый

  • 31.

    Mori, T. et al. Посттравматическая растяжка способствует восстановлению на крысиной модели мышечного повреждения, вызванного удлинением сокращений. J. Physiol. Sci. https://doi.org/10.1007/s12576-017-0553-9 (2017).

  • 32.

    Song, G. et al. Механическое растяжение способствует пролиферации мезенхимальных стволовых клеток костного мозга крысы. Colloids Surf. B Биоинтерфейсы 58 , 271–277 (2007).

    CAS Статья Google ученый

  • 33.

    Sun, L. et al. Влияние механического растяжения на пролиферацию клеток и формирование матрикса мезенхимальных стволовых клеток и фибробластов передней крестообразной связки. Stem Cells Int. 2016 , 9842075 (2016).

    PubMed PubMed Central Google ученый

  • 34.

    Ю, Х. С., Ким, Дж. Дж., Ким, Х. В., Льюис, М. П. и Уолл, И. Влияние механического растяжения на поведение клеток в костях и окружающих тканях. J. Tissue Eng. 7 , 2041731415618342 (2016).

    Артикул Google ученый

  • 35.

    Eckes, B. et al. Механическое напряжение и интегрин альфа 2 бета 1 регулируют функции фибробластов. J. Investig. Дерматол. Symp. Proc. 11 , 66–72 (2006).

    CAS Статья Google ученый

  • 36.

    Kippenberger, S. et al. Передача сигналов о механическом растяжении кератиноцитов человека через киназы MAP. J. Invest. Дерматол. 114 , 408–412 (2000).

    CAS Статья Google ученый

  • 37.

    Lu, D. et al. Асимметричная миграция кератиноцитов человека при механическом растяжении и сокультивированных фибробластах в модели заживления ран. PLoS ONE 8 , e74563 (2013).

    ADS CAS Статья Google ученый

  • 38.

    Токуяма, Э., Нагаи, Ю., Такахаши, К., Кимата, Ю. и Нарус, К. Механическое растяжение эквивалентов кожи человека увеличивает толщину эпидермиса и развивает базальную мембрану. PLoS ONE 10 , e0141989 (2015).

    Артикул Google ученый

  • 39.

    Ли Ю., Гил М. С. и Хонг Дж. Дж. Гистоморфологические изменения волосяных фолликулов расширенной кожи головы человека. Пласт. Реконстр. Surg. 105 , 2361–2365 (2000).

    CAS Статья Google ученый

  • 40.

    Bao, C. et al. Блокада рецептора интерлейкина-7 формирует альтернативную активацию макрофагов и способствует функциональному восстановлению после повреждения спинного мозга. Неврология https://doi.org/10.1016 / j.neuroscience.2017.10.022 (2017).

  • 41.

    Мартинес, Ф. О., Хелминг, Л. и Гордон, С. Альтернативная активация макрофагов: иммунологическая функциональная перспектива. Annu. Rev. Immunol. 27 , 451–483 (2009).

    CAS Статья Google ученый

  • 42.

    ter Horst, E. N. et al. Модуляторы поляризации макрофагов влияют на заживление инфаркта миокарда. Внутр.J. Mol. Sci. 16 , 29583–29591 (2015).

    Артикул Google ученый

  • 43.

    Xing, L. et al. Роль макрофагов M2 в остром повреждении почек, вызванном сепсисом. Ударная https://doi.org/10.1097/SHK.0000000000001006 (2017).

  • 44.

    Cheng, Y. & Rong, J. Поляризация макрофагов как терапевтическая мишень при инфаркте миокарда. Curr. Цели по наркотикам https://doi.org/10.2174/1389450118666171031115025 (2017).

  • 45.

    Osaka, N. et al. ASK1-зависимый набор и активация макрофагов вызывают рост волос в кожных ранах. J. Cell. Биол. 176 , 903–909 (2007).

    CAS Статья Google ученый

  • 46.

    Wang, X. et al. Макрофаги индуцируют AKT / бета-катенин-зависимую активацию стволовых клеток Lgr5 + и регенерацию волосяных фолликулов через TNF. Nat.Commun. 8 , 14091 (2017).

    ADS CAS Статья Google ученый

  • 47.

    Qi, Y. et al. Терапевтическая роль фактора роста гепатоцитов человека (HGF) в лечении выпадения волос. PeerJ 4 , e2624 (2016).

    Артикул Google ученый

  • 48.

    Эль Касми, К. К. и Стенмарк, К. Р. Вклад метаболического перепрограммирования в пластичность и функцию макрофагов. Семин. Иммунол. 27 , 267–275 (2015).

    CAS Статья Google ученый

  • 49.

    He, C. & Carter, A. B. Метаболические перспективы и окислительно-восстановительное регулирование поляризации макрофагов. J. Clin. Cell Immunol. 6 , https://doi.org/10.4172/2155-9899.1000371 (2015).

  • 50.

    Adair-Kirk, T. L. et al. Хемотаксический пептид из ламинина альфа 5 действует как регулятор воспалительных иммунных ответов через TNF-альфа-опосредованную передачу сигналов. J. Immunol. 174 , 1621–1629 (2005).

    CAS Статья Google ученый

  • 51.

    Hance, K. A., Tataria, M., Ziporin, S. J., Lee, J. K. & Thompson, R. W. Хемотаксическая активность моноцитов при аневризмах брюшной аорты человека: роль пептидов деградации эластина и рецептора эластина на поверхности клетки 67 кДа. J. Vasc. Surg. 35 , 254–261 (2002).

    Артикул Google ученый

  • 52.

    Адаир-Кирк, Т. Л. и Сеньор, Р. М. Фрагменты внеклеточного матрикса как медиаторы воспаления. Внутр. J. Biochem. Клетка. Биол. 40 , 1101–1110 (2008).

    CAS Статья Google ученый

  • 53.

    McKee, C.M. et al. Фрагменты гиалуронана (НА) индуцируют экспрессию гена хемокина в альвеолярных макрофагах. Роль размера HA и CD44. J. Clin. Инвестировать. 98 , 2403–2413 (1996).

    CAS Статья Google ученый

  • 54.

    Jiang, A. et al. Нарушение адгезии, опосредованной Е-кадгерином, вызывает функционально отличный путь созревания дендритных клеток. Иммунитет 27 , 610–624 (2007).

    Артикул Google ученый

  • 55.

    Эванс, Н. Д., Ореффо, Р. О., Хили, Э., Тернер, П. Дж. И Ман, Ю. Х. Эпителиальная механобиология, заживление кожных ран и ниша стволовых клеток. J. Mech. Behav. Биомед. Матер. 28 , 397–409 (2013).

    Артикул Google ученый

  • 56.

    Карольчик Д. и др. База данных браузера генома UCSC. Nucleic Acids Res. 31 , 51–54 (2003).

    CAS Статья Google ученый

  • 57.

    Kim, D. et al. TopHat2: точное выравнивание транскриптомов при наличии вставок, делеций и слияний генов. Genome Biol. 14 , R36 (2013).

    Артикул Google ученый

  • 58.

    Trapnell, C. et al. Дифференциальный анализ регуляции генов при разрешении транскриптов с помощью RNA-seq. Nat. Biotechnol. 31 , 46–53 (2013).

    CAS Статья Google ученый

  • 59.

    Хуанг да В., Шерман Б. Т. и Лемпицки Р. А. Систематический и комплексный анализ больших списков генов с использованием ресурсов биоинформатики DAVID. Nat. Protoc. 4 , 44–57 (2009).

    Артикул Google ученый

  • Внутренняя активация роста и дифференцировки клеток в культивируемых ex vivo волосяных фолликулах человека посредством временного эндогенного производства ROS

    Все методы были выполнены в соответствии со всеми соответствующими институциональными и экспериментальными и этическими руководящими принципами ЕС.

    Ex vivo культура человеческих волосяных фолликулов

    Человеческие волосяные фолликулы были получены из образцов кожи головы человека, взятых с затылочной кожи добровольцев-доноров во время процедуры трансплантации волос.Приемлемые пациенты предоставили письменное информированное согласие, и этический комитет университетской больницы Рамон-и-Кахал одобрил эту процедуру. Фолликулярные единицы (ФЕ) в фазе покоя (телоген), обычно содержащие один или два волосяных фолликула и окружающие остатки жировой и дермальной ткани, были вскрыты и отобраны опытными трихологами дерматологической службы больницы Рамон-и-Кахаль с использованием стандартных морфологических критериев. ФУ выращивали в среде Williams E (Sigma) с добавлением 10x пеницилина / стрептомицина, 10x амфотерицина B и 2 мМ L-глутамина (все от Gibco), 5 мкг / мл инсулина, 5 мкг / мл переносчика, 20 пМ гормона Т3, 0.083 мкг / мл холерного токсина и 0,4 мкг / мл гидрокортизона при 37 ° C в увлажненной атмосфере с 5% CO. 2 . Остатки прилипшей ткани в FU поддерживались на протяжении всего процесса роста ex vivo для улучшения жизнеспособности волосяных фолликулов в базальных условиях. В каждой серии экспериментов использовались ФУ из одного и того же человека и одного тела.

    Производство ROS

    Модифицированная (запатентованная для всех коммерческих целей) PpIX-зависимая фотодинамическая обработка была использована для активации временного производства нелетальных эндогенных уровней ROS в волосяных фолликулах человека in vivo .С этой целью ФЕ инкубировали в течение 4 часов с 0,1–1 мМ MAL (Sigma) в полной среде Williams E, а затем облучали в течение 10 минут красным светоизлучающим диодным источником с пиком излучения при ширине полосы 634 нм, с общая световая доза 3,72 Дж / см 2 . Во все экспериментальные планы были включены световые контроли без МАЛ. Условия PT + inh проводили, добавляя поглотители ROS N-ацетил-L-цистеин и аскорбиновую кислоту (NAC и AA, оба от Sigma-Aldrich) в конечной концентрации 3 мМ и 100 мкМ, соответственно, за 30 мин до красного света. воздействие, чтобы ослабить эффекты, связанные с ROS.После обработки добавляли свежую среду. Чтобы подавить сигнальную активность WNT, использовали специфический ингибитор PNU-74654 (Santa Cruz Biotech) в конечной концентрации 40 мкМ, разбавленный полной средой Вильямса E. PNU-74654 был первоначально добавлен в среду в той же самой среде, что и MAL. и поддерживали до конца экспериментов, заменяя каждый день свежей средой, содержащей ингибитор.

    Количественное определение ROS

    Определение и количественное определение продукции ROS проводили с использованием флуоресцентных зондов 2 ', диацетата 7-дихлородигидрофлуоресцеина (DHF-DA, Sigma-Aldrich) и реагента синглетного кислорода Sensor Green (Thermo Fisher).Зонды разводили в среде Williams E во время инкубации MAL до конечной концентрации 10 мкМ за 30 мин до облучения красным светом. Через 30 минут после облучения красным светом волосяные фолликулы дважды промывали физиологическим раствором, помещали в черный многолуночный планшет с физиологическим раствором и планшет переносили в устройство IVIS (система изображений IVIS Lumina 2, xenogeny). Производство АФК оценивали путем измерения сигнала DCF, выбирая подходящие фильтры (445–490 нм для полосы возбуждения, 515–575 нм для полосы излучения).

    Параметры оптического сбора данных были скорректированы для получения уровня сигнала от 600 до 60000 относительных люксов. С этой целью окисленные молекулы h3-DCF-DA (DCF) возбуждали в течение 1 секунды времени экспозиции с апертурой (количество собираемого света, F / Stop), равным 8. Для улучшения отношения сигнал / шум для считывания. noise, был выбран Small Binning. Данные собирали в виде подсчетов (фотоны / сек / см 2 ) с использованием программного обеспечения Living Image v2.50 (Xenogen). Минимальную цветовую шкалу отрегулировали для отрицательного контроля (FU без DHF-DA), а максимальную цветовую шкалу - для области PT.Области интереса (ROI) были скорректированы в соответствии с размером лунок, и измерения флуоресценции каждой области интереса были экспортированы в формате Excel. Рассчитывали соотношение между общим количеством и выбранной площадью и сравнивали как кратное изменение между PT и контролем или PT + inh и контролем. Т-тест использовался для статистического анализа.

    Гистологический анализ

    Для гистологического анализа ФЕ фиксировали в 3,7% водном растворе формальдегида с нейтральным pH и заливали парафином с использованием стандартных процедур.Обычно для каждого FU получали продольные срезы ткани 18–22, толщиной 6 мкм. Как правило, для сравнительного анализа использовалось как можно больше 6–4 центральных участков, охватывающих как можно больше по всей длине, по крайней мере, надбульбарных участков волокон и волосяных луковиц. Срезы остаточной ткани использовались для выполнения иммунологических процедур (см. Ниже). Для анализа морфологических изменений на тканевом уровне гистологически эквивалентные срезы оценивали путем окрашивания трихромом по Массону. Получение изображения в светлом поле выполнялось с использованием Nikon Eclipse Ci, соединенного с камерой Jenoptik PROGRES GRYPHAX ® SUBRA Super HD и подходящей версии 1.Пакет программного обеспечения для изображений 1.8.153.

    Количественная оценка площади волосяной луковицы и утолщения супрабульбарных волокон

    Для оценки значительных морфологических изменений in vivo в целых волосяных фолликулах изображения с высоким разрешением ФЕ, растущих в 24-луночных планшетах, были получены в момент времени 0 после ПК и каждый 24 часа и более в течение минимум 7 и максимум 19 дней, в зависимости от условий эксперимента. Получение изображений производилось с помощью светодиодного флуоресцентного микроскопа Nikon Eclipse Ci с объективом 2x и объективом 0.Адаптер уменьшающего объектива 55x, подключенный к камере Jenoptik PROGRES GRYPHAX ® SUBRA Super HD. Общая площадь волосяных луковиц на изображениях целых волосяных фолликулов с высоким разрешением была определена и количественно оценена с использованием подходящих бесплатных пакетов программного обеспечения FIJI (https://fiji.sc/). Было представлено среднее +/- SD измерений волосяных луковиц в n ≥ 12 образцах для каждого экспериментального условия, и Т-тест был использован для статистического анализа. Поскольку прилипшие остатки ткани в растущих FU не позволяют получить точное изображение in vivo волосяного волокна, эквивалентные гистологические срезы медиальной области волосяного фолликула были использованы для оценки утолщения надбульбарной области волокна.Для этого набора измерений были выбраны волосяные фолликулы на 7-й день. Изображения с высоким разрешением срезов, окрашенных трихромом Массона или DAPI, полученные в светодиодном флуоресцентном микроскопе Nikon Eclipse Ci, были использованы для количественной оценки поперечной длины волосяного волокна в трех отдельных местах супрабульбарной области, проксимальной, медиальной и дистальной, для каждого из них. волосяной фолликул (см. рис. 3А). Среднее значение этих трех измерений использовалось в качестве основного значения толщины супрабульбарных волокон волосяного фолликула. Было представлено среднее +/- SD толщины супрабульбара в n = 3 образцах для каждого экспериментального условия, и Т-тест был использован для статистического анализа.

    Экстракция РНК и анализ экспрессии гена

    Суммарная РНК, по крайней мере, 4 FU в каждой экспериментальной группе была извлечена через 7 дней после обработки с использованием микрокомплекта RNeasy (Qiagen). РНК нормализовали по количеству FU в каждом экспериментальном состоянии, а затем преобразовывали в кДНК с использованием набора кДНК FastGene Scriptase II (Nippon genetics). Данные qRT-PCR анализировали с использованием сравнительного метода CT, используя экспрессию 18S рибосомной РНК в качестве внутреннего контроля. Кратные изменения экспрессии генов были представлены как отношение между средними значениями 2 -ΔCt значений MAL FU и средними значениями Light control FU.Генные мишени и праймеры (чтение 5'– 3 '), используемые для амплификаций, были следующими:

    CCND1: Fw-ACGAAGGTCTGCGCGTGTT; Rev- CCGCTGGCCATGAACTACCT

    GSK3β: Fw- AACTGCCCGACTAACAACAC; Rev- ATTGGTCTGTCCACGGTCTC

    VEGF: Fw- GAGATGTCCCTGGAAGAACACA; Rev- GAGTGGGATGGGTGATGTCAG

    ID2: Fw- GCTATACAACATGAACGACTGCT; Rev- AATAGTGGGATGCGAGTCCAG

    AXIN2c: Fw- GGTGTTTGAGGAGATCTGGG; Rev- TGCTCACAGCCAAGACAGTT

    BMP4: Fw- AAAGTCGCCGAGATTCAGGG; Rev- GACGGCACTCTTGCTAGGC

    DKK1: Fw- CCTTGAACTCGGTTCTCAATTCC; Rev- CAATGGTCTGGTACTTATTCCCG

    18S: Fw- CGGCTACCACATCCAAGGAA; Rev- GCTGGAATTACCGCGGCT

    Иммунолокализация белка

    Для определения локализации целевого белка и паттернов экспрессии в волосяных фолликулах использовали гистологические срезы тканей.По крайней мере, один ФУ в каждой экспериментальной группе фиксировали в 3,7% водном растворе формальдегида и заливали парафином, как описано выше. Извлечение антигена выполняли с использованием 10 мМ цитратного буфера в гидратированных срезах в соответствии со стандартными процедурами. Первичные антитела, включая анти-Цитокератин 15 (CK15, клон EPR16Y, Abcam) и анти-KI67 (клон SP6, Abcam), анти-E-кадгерин (ECCD1; клон 24E10, Cell Signaling), анти-TCF4 (клон D4, Santa Cruz Biotech) и анти-DKK1 (клон B7, Santa Cruz Biotech) инкубировали в течение ночи при 4 ° C во влажной камере, тщательно промывали PBS, инкубировали в течение 1 часа при комнатной температуре с соответствующими вторичными флуоресцентно-меченными антителами и устанавливали. в DAPI (100 нг / мл) -содержащем Vectashield.Конфокальные изображения были получены на спектральном конфокальном микроскопе Leica TCS SP5 AOBS и обработаны с помощью программы FIJI.

    Нервные стволовые клетки восстанавливают рост волос за счет активации ниши волосяного фолликула - Корейский университет

    TY - JOUR

    T1 - Нервные стволовые клетки восстанавливают рост волос за счет активации ниши волосяного фолликула

    AU - Hwang, Insik

    AU - Choi, Kyung Ah

    AU - Park, Hang Soo

    AU - Jeong, Hyesun

    AU - Kim, Jeong Ok

    AU - Seol, Ki Cheon

    AU - Kwon, Han Jin

    AU - Park, In Hyun

    AU - Hong, Sunghoi

    N1 - Информация о финансировании: Эта работа была поддержана грантами Министерства науки, ИКТ и планирования будущего (2012M3A9C6050131) и Министерства здравоохранения и социального обеспечения (HR14C0007) правительства Республики Корея.I.-H.P. при частичной поддержке Национальных институтов здравоохранения (NIH) (GM0099130-01, GM111667-01) и CSCRF (12-SCBYALE-11, 13-SCB-YALE-06). Авторы заявляют никакого конфликта интересов. Авторские права издателя: © 2016 ООО «Когнизант». Авторское право: Copyright 2017 Elsevier B.V., Все права защищены.

    PY - 2016

    Y1 - 2016

    N2 - Некоторые типы выпадения волос возникают в результате неспособности волосяных фолликулов инициировать анагеновую фазу цикла регенерации волос. Модуляция сигнальных путей в нише волосяного фолликула может стимулировать вступление в фазу анагена.Несмотря на значительные усилия, методы лечения на основе стволовых клеток или фармакологии для активации ниши волосяных фолликулов не увенчались успехом. Здесь мы решили проверить влияние экстракта нервных стволовых клеток (NSC) на нишу волосяного фолликула на возобновление роста волос. Экстракты NSC наносили на иммортализованные клеточные линии HaCaT, кератиноциты и клетки дермального сосочка (DPC), а также на выбритую спинную кожу мышей. Лечение экстрактом NSC резко улучшило рост кератиноцитов HaCaT и DPC. Кроме того, экстракт NSC усиливал рост волос на бритой спинной части кожи мышей.Чтобы определить молекулярные пути передачи сигналов, регулируемые NSC, мы оценили уровни экспрессии нескольких факторов роста и передачи сигналов, таких как инсулиноподобный фактор роста-1 (IGF-1), фактор роста гепатоцитов (HGF), фактор роста кератиноцитов ( KGF), фактор роста эндотелия сосудов (VEGF), трансформирующий фактор роста-b (TGF-b) и члены семейства костных морфогенетических белков (BMP). Мы обнаружили, что лечение экстрактом NSC усиливает рост волос за счет активации ниш волосяных фолликулов посредством корегуляции сигнальных путей TGF-b и BMP в фазе телогена.Мы также наблюдали активацию и дифференцировку внутрифолликулярных стволовых клеток волосяных фолликулов, матричных клеток и экстрафолликулярных DPC in vivo и in vitro. Мы проверили, является ли активация путей фактора роста основным эффектом лечения НСК на рост волос путем нанесения факторов роста на кожу мыши. Комбинированные факторы роста, включая TGF-b, значительно увеличивали длину стержня волоса и скорость роста. Повреждение ДНК и гибель клеток не наблюдались в клетках кожи мышей, получавших экстракт NSC в течение длительного периода.В целом, наши данные демонстрируют, что экстракт NSC обеспечивает эффективный подход к стимулированию роста волос путем непосредственной регуляции ниш волосяных фолликулов посредством сигнальных путей TGF-b и BMP, а также индукции основных факторов роста.

    AB - Некоторые типы выпадения волос возникают в результате неспособности волосяных фолликулов инициировать фазу анагена цикла регенерации волос. Модуляция сигнальных путей в нише волосяного фолликула может стимулировать вступление в фазу анагена. Несмотря на значительные усилия, методы лечения на основе стволовых клеток или фармакологии для активации ниши волосяных фолликулов не увенчались успехом.Здесь мы решили проверить влияние экстракта нервных стволовых клеток (NSC) на нишу волосяного фолликула на возобновление роста волос. Экстракты NSC наносили на иммортализованные клеточные линии HaCaT, кератиноциты и клетки дермального сосочка (DPC), а также на выбритую спинную кожу мышей. Лечение экстрактом NSC резко улучшило рост кератиноцитов HaCaT и DPC. Кроме того, экстракт NSC усиливал рост волос на бритой спинной части кожи мышей. Чтобы определить молекулярные пути передачи сигналов, регулируемые NSC, мы оценили уровни экспрессии нескольких факторов роста и передачи сигналов, таких как инсулиноподобный фактор роста-1 (IGF-1), фактор роста гепатоцитов (HGF), фактор роста кератиноцитов ( KGF), фактор роста эндотелия сосудов (VEGF), трансформирующий фактор роста-b (TGF-b) и члены семейства костных морфогенетических белков (BMP).Мы обнаружили, что лечение экстрактом NSC усиливает рост волос за счет активации ниш волосяных фолликулов посредством корегуляции сигнальных путей TGF-b и BMP в фазе телогена. Мы также наблюдали активацию и дифференцировку внутрифолликулярных стволовых клеток волосяных фолликулов, матричных клеток и экстрафолликулярных DPC in vivo и in vitro. Мы проверили, является ли активация путей фактора роста основным эффектом лечения НСК на рост волос путем нанесения факторов роста на кожу мыши. Комбинированные факторы роста, включая TGF-b, значительно увеличивали длину стержня волоса и скорость роста.Повреждение ДНК и гибель клеток не наблюдались в клетках кожи мышей, получавших экстракт NSC в течение длительного периода. В целом, наши данные демонстрируют, что экстракт NSC обеспечивает эффективный подход к стимулированию роста волос путем непосредственной регуляции ниш волосяных фолликулов посредством сигнальных путей TGF-b и BMP, а также индукции основных факторов роста.

    KW - Ниша волосяного фолликула

    KW - Рост волос

    KW - Экстракт нервных стволовых клеток

    KW - Трансформирующий фактор роста β (TGF-β)

    UR - http: // www.scopus.com/inward/record.url?scp=849828&partnerID=8YFLogxK

    UR - http://www.scopus.com/inward/citedby.url?scp=849828&partnerID=8YFLogxK

    43
    62 U2 -
    43
    62 U2 - 10.3727 / 096368916X691466

    M3 - Артикул

    C2 - 27110030

    AN - SCOPUS: 849828

    VL - 25

    SP - 1439

    EP - 1451

    JO Трансплантация клеток

    JO - 1451

    JO SN - 0963-6897

    IS - 8

    ER -

    Исследователи выяснили, как хронический стресс приводит к выпадению волос - Harvard Gazette

    Исследователи Гарвардского университета определили биологический механизм, с помощью которого хронический стресс повреждает стволовые клетки волосяного фолликула, подтверждая давние наблюдения о том, что стресс может приводить к выпадению волос.

    В исследовании на мышах, опубликованном в журнале Nature, исследователи обнаружили, что главный гормон стресса переводит стволовые клетки волосяного фолликула в длительную фазу покоя, не регенерируя фолликул или волосы. Исследователи определили конкретный тип клеток и молекулу, отвечающую за передачу сигнала стресса стволовым клеткам, и показали, что этот путь потенциально может быть направлен на восстановление роста волос.

    «Моя лаборатория заинтересована в понимании того, как стресс влияет на биологию стволовых клеток и биологию тканей, отчасти благодаря тому факту, что каждый может рассказать историю о том, что происходит с его кожей и волосами, когда они находятся в состоянии стресса.Я понял, что как биолог, специализирующийся на стволовых клетках кожи, я не могу дать удовлетворительный ответ относительно того, действительно ли стресс оказывает влияние - и, что более важно, если да, то каковы механизмы », - сказал Я-Чие Сюй, сотрудник Alvin and Esta Star Associate. Профессор стволовых клеток и регенеративной биологии Гарварда и старший автор исследования. «Кожа представляет собой управляемую и доступную систему для глубокого изучения этой важной проблемы, и в этой работе мы обнаружили, что стресс действительно задерживает активацию стволовых клеток и фундаментально меняет частоту регенерации тканей стволовыми клетками волосяного фолликула.”

    Волосяной фолликул - одна из немногих тканей млекопитающих, которая может подвергаться циклам регенерации в течение жизни, и стала парадигмой, которая во многом определяет наше фундаментальное понимание биологии стволовых клеток млекопитающих. Волосяной фолликул естественным образом колеблется между ростом и отдыхом, и этот процесс поддерживается стволовыми клетками волосяного фолликула. Во время фазы роста стволовые клетки волосяного фолликула активируются для регенерации фолликула и волос, и волосы становятся длиннее с каждым днем. Во время фазы покоя стволовые клетки находятся в состоянии покоя, и волосы легче выпадают.Выпадение волос может произойти, если волосы выпадают, а стволовые клетки остаются неподвижными без регенерации новой ткани.

    Под волосяным фолликулом мыши клетки кожного сосочка (зеленые) производят молекулу Gas6, которая активирует стволовые клетки волосяного фолликула. Предоставлено: лаборатория Сюй, Гарвардский университет,

    . Исследователи изучили модель хронического стресса на мышах и обнаружили, что стволовые клетки волосяного фолликула остаются в фазе покоя в течение очень долгого времени, не регенерируя ткани. Главный гормон стресса, вырабатываемый надпочечниками, кортикостерон, активизировался хроническим стрессом; введение мышам кортикостерона воспроизводило стрессовое воздействие на стволовые клетки.Эквивалентным гормоном у людей является кортизол, который также активируется при стрессе и часто называется «гормоном стресса».

    «Этот результат предполагает, что повышенный уровень гормонов стресса действительно оказывает негативное влияние на стволовые клетки волосяного фолликула», - сказал Хсу. «Но настоящее удивление произошло, когда мы исключили источник гормонов стресса».

    В нормальных условиях регенерация волосяных фолликулов со временем замедляется - фаза покоя удлиняется с возрастом животных. Но когда исследователи удалили гормоны стресса, фаза покоя стволовых клеток стала чрезвычайно короткой, и мыши постоянно входили в фазу роста для регенерации волосяных фолликулов на протяжении всей своей жизни, даже когда они были старыми.

    «Таким образом, даже базовый уровень гормона стресса, который обычно циркулирует в организме, является важным регулятором фазы покоя. По сути, стресс просто поднимает эту уже существующую «ось надпочечник – волосяной фолликул», что еще больше затрудняет переход стволовых клеток волосяного фолликула в фазу роста для регенерации новых волосяных фолликулов », - сказал Хсу.

    Установив связь между гормоном стресса и активностью стволовых клеток волосяного фолликула, исследователи искали биологический механизм, лежащий в основе этой связи.

    «И в нормальных, и в стрессовых условиях добавления Gas6 было достаточно для активации стволовых клеток волосяных фолликулов, которые находились в фазе покоя, и для стимулирования роста волос».

    - Секю Чой, ведущий автор исследования

    «Сначала мы спросили, регулирует ли гормон стресса напрямую стволовые клетки, и проверили, удалив рецептор кортикостерона, но это оказалось неправильным. Вместо этого мы обнаружили, что гормон стресса на самом деле действует на кластер дермальных клеток под волосяным фолликулом, известный как дермальный сосочек », - сказал Секю Чой, ведущий автор исследования.

    Известно, что дермальный сосочек имеет решающее значение для активации стволовых клеток волосяного фолликула, но ни один из ранее идентифицированных факторов, секретируемых дермальным сосочком, не изменился при изменении уровня гормона стресса. Скорее, гормон стресса не позволял клеткам кожных сосочков секретировать Gas6, молекулу, которая, как показали исследователи, может активировать стволовые клетки волосяного фолликула.

    «И в нормальных, и в стрессовых условиях добавления Gas6 было достаточно для активации стволовых клеток волосяных фолликулов, которые находились в фазе покоя, и для стимулирования роста волос», - сказал Чой.«В будущем путь Gas6 может быть использован из-за его потенциала в активации стволовых клеток, способствующих росту волос. Также будет очень интересно изучить, связаны ли другие связанные со стрессом тканевые изменения с влиянием гормона стресса на регулирование Gas6 ».

    Эти первоначальные результаты на мышах необходимо дополнительно изучить, прежде чем их можно будет безопасно применить на людях. Управление технологического развития Гарварда защитило интеллектуальную собственность, относящуюся к этой работе, и изучает возможности сотрудничества по ее дальнейшему развитию и возможной коммерциализации.

    В прошлом году группа Хсу обнаружила, как стресс влияет на другой тип стволовых клеток в волосяном фолликуле: стволовые клетки меланоцитов, которые регенерируют пигмент волос. Исследователи обнаружили, что стресс активирует симпатическую нервную систему и истощает стволовые клетки меланоцитов, что приводит к преждевременному поседению волос. В новом исследовании два вывода вместе демонстрируют, что, хотя стресс оказывает пагубное влияние как на стволовые клетки волосяных фолликулов, так и на стволовые клетки меланоцитов, механизмы различны.Стресс истощает стволовые клетки меланоцитов напрямую через сигналы, полученные от нервов, в то время как стресс не позволяет стволовым клеткам волосяных фолликулов создавать новые волосы косвенно, через воздействие гормона стресса, производимого надпочечниками, на нишу. Поскольку стволовые клетки волосяного фолликула не истощаются, возможно, будет возможно реактивировать стволовые клетки в условиях стресса с помощью таких механизмов, как путь Gas6.

    Помимо потенциального применения пути Gas6 для стимулирования роста волос, результаты исследования имеют более широкое значение для биологии стволовых клеток.

    «При поиске факторов, контролирующих поведение стволовых клеток, обычно мы ищем локально в коже. Несмотря на то, что существуют важные местные факторы, наши результаты показывают, что главный переключатель активности стволовых клеток волосяных фолликулов на самом деле находится далеко в надпочечниках и работает, изменяя порог, необходимый для активации стволовых клеток », - сказал Хсу.

    «Вы можете системно контролировать поведение стволовых клеток, находящихся в другом органе, который играет действительно важную роль, и мы изучаем все больше и больше примеров этих« межорганных взаимодействий ».«Биология тканей взаимосвязана с физиологией тела. Нам еще так много предстоит узнать в этой области, но наши открытия постоянно напоминают нам о том, что для понимания стволовых клеток в коже нам часто нужно думать не только о коже ».

    Эта работа была частично поддержана New York Stem Cell Foundation, Smith Family Foundation Odyssey Award, Pew Charitable Trusts, Гарвардским институтом стволовых клеток, Harvard HMS Dean's Award, Американским онкологическим обществом, Наградой исследователей MGH Джеймса и Одри Фостер, NARSAD Премия молодого исследователя, Фонд MGH ECOR, Департамент здравоохранения штата Нью-Йорк и Национальные институты здравоохранения.

    The Daily Gazette

    Подпишитесь на ежедневную рассылку новостей Гарварда.

    Активизация роста волос с небольшой помощью кожи

    Целый срез кожи, показывающий волосяные фолликулы (синие), окруженные скоплениями резидентных макрофагов кожи (красные). Молекулярная связь между макрофагами и стволовыми клетками волосяного фолликула регулирует начало роста волосяного фолликула. Предоставлено: Донателло Кастельяна, CNIO.

    Восстановление облысения - задача не только косметологов.Предыдущие исследования выявили сигналы от кожи, которые помогают стимулировать новые фазы роста волос. Однако то, как различные типы клеток, которые находятся в коже, взаимодействуют, чтобы активировать рост волос, продолжает озадачивать биологов. Захватывающее исследование, опубликованное 23 декабря в журнале открытого доступа PLOS Biology , раскрывает новый способ стимулирования роста волос.

    Группа из Испанского национального центра исследований рака (CNIO) обнаружила неожиданную связь - связь между защитной системой организма и регенерацией кожи.Оказывается, в этом участвуют макрофаги. Это клетки иммунной системы, которые отвечают за поглощение вторгающихся патогенов, процесс, называемый фагоцитозом. Авторы сообщают, что макрофаги вызывают рост волос, окружая и активируя клетки кожи, обладающие регенеративной способностью, называемые стволовыми клетками. Открытие того, что макрофаги активируют стволовые клетки кожи, может повлиять на технологии с потенциальным применением в регенерации тканей, старении и раке.

    Авторами исследования являются Мирна Перес-Морено и Донателло Кастеллана из группы биологии эпителиальной клетки Программы биологии раковых клеток Фонда BBVA-CNIO, а также Ральф Паус, эксперт по иммунобиологии волос из Университета Манчестера и Мюнстера.«Мы обнаружили, что макрофаги, клетки, основная функция которых традиционно приписывается борьбе с инфекциями и заживлению ран, также участвуют в активации стволовых клеток волосяных фолликулов в невоспаленной коже», - говорит Перес-Морено.

    Эти результаты были получены в результате наблюдения Перес-Морено, когда она работала над другим исследовательским проектом. Интересно, что мыши, с которыми она работала в то время, начали отращивать волосы, когда им дали противовоспалительные препараты. Интересно, может ли тесная связь между стволовыми и иммунными клетками объяснить это наблюдение, лаборатория Перес-Морено начала тестировать различные типы клеток, участвующих в защитной системе организма, на их роль в росте волос.Они заметили, что, когда клетки кожи находятся в спящем состоянии, часть макрофагов умирает естественным образом из-за нормального процесса, называемого апоптозом. Удивительно, но умирающие и выжившие клетки активировали близлежащие стволовые клетки, и волосы снова начали расти.

    Макрофаги секретируют ряд факторов, включая класс сигнальных молекул, называемых Wnts. Важно отметить, что когда исследователи обрабатывали макрофаги препаратом-ингибитором Wnt, активация роста волос замедлялась, что демонстрирует роль Wnt из макрофагов в стимулировании роста волос.Хотя это исследование проводилось на мышах, исследователи считают, что их открытие «может способствовать разработке новых стратегий лечения» роста волос у людей.

    Исследователи использовали крошечные капельки или липосомы для переноса препарата, использованного в исследовании. По словам Донателло Кастеллана, будущее использование липосом в качестве способа доставки лекарства к конкретным клеткам является многообещающим и может иметь дополнительные последствия для изучения нескольких патологий.

    С более фундаментальной точки зрения, это исследование представляет собой попытку понять, как изменение среды, окружающей стволовые клетки кожи взрослых, может регулировать их регенеративные способности.«Одна из текущих задач в области стволовых клеток - регулировать активацию пулов эндогенных стволовых клеток во взрослых тканях, чтобы способствовать регенерации без трансплантации», - говорит Перес-Морено.

    Благодаря этому исследованию теперь известно, что макрофаги играют ключевую роль в среде, окружающей стволовые клетки. «Наше исследование подчеркивает важность макрофагов как модуляторов в процессах регенерации кожи, выходящих за рамки их основной функции как фагоцитарных иммунных клеток», - говорят авторы в PLOS Biology .


    Активация пути может возобновить рост волос в спящих волосяных фолликулах
    Дополнительная информация: Кастеллана Д., Паус Р., Перес-Морено М. (2014) Макрофаги способствуют циклической активации стволовых клеток взрослых волосяных фолликулов. PLoS Biol 12 (12): e1002002. DOI: 10.1371 / journal.pbio.1002002 Предоставлено Публичная научная библиотека

    Цитата : Активация роста волос с небольшой помощью кожи (2014, 23 декабря) получено 1 сентября 2021 г. с https: // физ.org / news / 2014-12-hair-growth-skin.html

    Этот документ защищен авторским правом.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *