Матрикс формулы окрашивания: Крем-краска без аммиака MATRIX Color Sync – «Идеальный цвет для блондинок. Формула походящая для нейтрализации желтизны.»

Содержание

Крем-краска без аммиака MATRIX Color Sync – «Идеальный цвет для блондинок. Формула походящая для нейтрализации желтизны.»

Так захотелось поделиться с вами опытом моего домашнего окрашивания.

Из-за длительного карантина и финансовой ограниченности я стала искать варианты окрашивания волос дома. Пересмотрев множество видео-советов я остановилась на безамиачной краске MATRIX. Я стремилась получить приятный холодный блонд.

Краска MATRIX относится к профессиональным средствам для окрашивания волос, стоимость одного тюбика краски чуть больше 500 руб, в комплект не входят окислитель, перчатки и бальзам для волос.

Перед применением важно внимательно изучить инструкцию.

Благодаря своей уникальной формуле компонентов производитель обещает сохранить здоровье волос и получить эффект гладкости поверхности волоса с дополнительным сиянием.

Я впервые решилась на самостоятельтную покраску, до этого на протяжении многих лет я осветляла и окрашивала волосы в салоне.

Мой натуральный цвет волос- темнорусый на 5 уровне причем желтый пигмент после окрашивания проявляется довольно быстро. Мне было необходимо выровнять образовавшийся цвет волос после моей предыдущей тонировки, которая благополучно смылась.

До окрашивания

Отросшие корни я осветлила пудрой с 6% оксидом. А для тонировки использовала безамиачную краску MATRIX, для этого я смешала в равных пропорциях цвета 10А + 10 V + родной оксид от MATRIX 2,7% (90:90:180).

Краску я наносила сначала на корни, а затем по всей длине, на волосах выдержала 35 минут.

В отличие от аммиачных , эта краска не вызывает дискомфортных ощущений- какого-либо жжения и неприятного запаха.

На волосах цвет постепенно меняется, он темнеет и приобретает бежево-фиолетовый оттенок.

Один тюбик краски содержит 90ml, это отличный обем которого хватит для полной покраски волос средней длины. На мои длинные волосы объема двух тюбиков было много, но я переживала чтобы волосы хорошо прокрасились, поэтому использовала всю краску сразу.

Результат меня действительно порадовал: волосы стали блестящие и приобрели именно холодный оттенок которого я добивалась. Краска взялась равномерно, несмотря на то, что основа была далека от идеала. На фото сложно определить реальный цвет из за солнечного света.

После окрашивания

Результат после окрашивания

Смело можете использовать краску MATRIX для тонировки и нейтрализации желтизны в оттенках 10 А и 10V. Но будтье внимательны, что без аммиачная краска не закрашивает седину.

Спасибо за внимание, делитесь своими результатами и экспериментами.

Техника окрашивания

                 Техника окрашивания для создания объемного цвета.

Исходный цвет волос:  Уровень 5,седина 50-75%.( смотрите тему:  Как определить цвет волос

Формула А: Socolor beauty 505Na (60 мл)+6% (20 Vol) крем-оксидант Matrix (30 мл)

Формула В: Light master (30 мл)+9% (30 мл) крем оксидант Matrix (30 мл)

Формула С: ColorSync SPN (60 мл)+2,7 (9 Vol) активатор ColorSync (60 мл)
 
Техника окрашивания:
  1. Разделите волосы как показано на рисунке.

 

 

2. Нанесите состав формулы А на корни всей массы волос. Затем отделите горизонтальную прядь волос, отступим на 2 см от линии роста волос. Подложите под прядь лист фольги, и нанесите состав формулы В, начиная с концов волос до нанесения состава формулы А (не допускайте смешивания составов). Расположите поверх пряди еще один лист фольги для того, что бы изолировать ее.

 

3. Продолжайте отделять горизонтальные пряди в шахматном порядке, оставляя примерно 3 см между листами фольги, и работайте в той же технике до затылка.

4. Из оставшихся между фольгой волос выберите несколько прядей и нанесите состав формулы В от концов до середины длины  волос.

5. Создайте диагональную прядь на височной зоне, отступив 2 см от линии роста волос. Оттяните прядь на себя и нанесите состав формулы В ребром кисти от середины длины волос до концов. Мягко растушуйте краситель во избежания четкой линии перехода оттенка. В той же техники работайте на другой стороне.

 

6. Выдержите 35 минут. Смойте с помощью шампуня и кондиционера.

7. Нанесите состав С, тонируйте волосы. Выдержите 20 минут. Смойте используя шампунь и кондиционер.

8. Сделайте укладку.

 Техника окрашивания для создания объема.  Подойдет  для окрашивания натуральных волос с сединой, подчеркнет свой цвет и закрасит седину. Бренд матрикс предлагает вам использовать новые натуральные оттенки Socolor beauty Extra coverage- 505Na, 506Na, 508na b 509Na. Новые оттенки выглядят на столько естественными,что догадаться,что они окрашены только по блеску волос.

 

матрикс формулы окрашивания матрикс формулы окрашивания мастер класс матрикс форсунки матрикс форсунки характеристика матрикс форте матрикс

Eksis Visual Lab для объединения в сеть

Eksis Visual Lab для объединения в сеть Комплект поставки ПО: диск с описанием для портативных приборов: кабель RS-232 1м либо USB 1,8 м для стационарных приборов: кабель RS-232 10м + кабель USB 1,8 м

Подробнее

ЛАБОРАТОРНАЯ МЕБЕЛЬ СТОЛЫ СЛ-1, СЛ-2, СЛ-3-1, СЛ-3-2, СЛ-4-1, СЛ-4-2, СЛ-5-1, СЛ-5-2, СЛ-6-1, СЛ-6-2. По вопросам продаж и поддержки обращайтесь:

ЛАБОРАТОРНАЯ МЕБЕЛЬ СТОЛЫ СЛ-1, СЛ-2, СЛ-3-1, СЛ-3-2, СЛ-4-1, СЛ-4-2, СЛ-5-1, СЛ-5-2, СЛ-6-1, СЛ-6-2 По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Калининград (4012)72-03-81 Нижний

Подробнее

ЭЛЕКТРОПИЛЫ RD-CS 200, 160, 210, 150, 130, 190

ПРОИЗВОДСТВО СТРОИТЕЛЬНОЙ И САДОВОЙ ТЕХНИКИ ПРОМЫШЛЕННОГО И БЫТОВОГО НАЗНАЧЕНИЯ ЭЛЕКТРОПИЛЫ RD-CS 200, 160, 210, 150, 130, 190 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск

Подробнее

Выключатели кнопочные серии КЕ.

Выключатели кнопочные серии КЕ. Архангельск (88)6-90-7 Астана +7(77)77- Белгород (7)0–6 Брянск (8)9-0- Владивосток ()9-8- Волгоград (8)78-0-8 Вологда (87)6–9 Воронеж (7)0–7 Екатеринбург ()8–89 Иваново

Подробнее

Буры для перфоратора SDS+ HYUNDAI

Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31 Волгоград (844)278-03-48 Вологда (8172)26-41-59 Воронеж (473)204-51-73 Екатеринбург

Подробнее

b maxx PCC

b maxx PCC www.baumuller.nt-rt.ru По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31

Подробнее

БЛОКИ КОММУТАЦИИ ГАЗОВЫХ ЛИНИЙ

БЛОКИ КОММУТАЦИИ ГАЗОВЫХ ЛИНИЙ БКМ 5-1 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Казань (843)206-01-48 Новокузнецк (3843)20-46-81 Смоленск (4812)29-41-54

Подробнее

ДОПОЛНИТЕЛЬНОЕ ОБОРУДОВАНИЕ

ДОПОЛНИТЕЛЬНОЕ ОБОРУДОВАНИЕ КОМПЛЕКТЫ ОПТОГОЛОВКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Калининград (4012)72-03-81 Нижний Новгород (831)429-08-12 Смоленск (4812)29-41-54

Подробнее

Протекторы алюминиевые П-КОА

Протекторы алюминиевые П-КОА Технические характеристики Архангельск (8182)63–72 Астана +7(7172)727-132 Астрахань (8512)99-46-04 Барнаул (3852)73-04-60 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток

Подробнее

СКВАЖИННЫЕ НАСОСЫ 8799 BP/65, 8798 BP/50, 8797 BP/35, 8796 BP/20, 8776 BP/65, 8775 BP/50, 8774 BP/35, 8773 BP/20 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ СКВАЖИННЫЕ НАСОСЫ 8799 P/65, 8798 P/50, 8797 P/35, 8796 P/20, 8776 P/65, 8775 P/50, 8774 P/35, 8773 P/20 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки

Подробнее

ИНВЕРТОРНЫЕ ЗАРЯДНЫЕ УСТРОЙСТВА

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ ИНВЕРТОРНЫЕ ЗАРЯДНЫЕ УСТРОЙСТВА STRIKER 26 M, 23 M, 10 M, 10 A, 8, 4 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72

Подробнее

УДАРНЫЕ ДРЕЛИ ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ. По вопросам продаж и поддержки обращайтесь:

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ УДАРНЫЕ ДРЕЛИ 2500 A, 2500 AK, 2500, 2510, 2510 K1, 2520 K, 2521, 2521 K2, 2530, 2560, 2530 K3, 2570, 2610, 2612, 2562, 2552, 2532, 2522, 2512 ТЕХНИЧЕСКИЕ

Подробнее

+7 /351/ ; +7 /351/ ;

ПРАЙС-ЛИСТ ОТ 01.10.2013г. Вся дополнительная информация и подробное описание, на сайте www.mdnt.ru/med/dir/phisiotherapy (Все цены указаны в российских рублях) ВНИМАНИЕ! Аппараты Мустанг-2000 сняты с

Подробнее

Тепловая техника Калибр

Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31 Волгоград (844)278-03-48 Вологда (8172)26-41-59 Воронеж (473)204-51-73 Екатеринбург

Подробнее

ЭЛЕКТРОПИЛЫ RD-EC 18, 08, 101

ПРОИЗВОДСТВО СТРОИТЕЛЬНОЙ И САДОВОЙ ТЕХНИКИ ПРОМЫШЛЕННОГО И БЫТОВОГО НАЗНАЧЕНИЯ ЭЛЕКТРОПИЛЫ RD-EC 18, 08, 101 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72

Подробнее

Мотоцикл Lifan 100-C(PONY)

По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Астрахань (8512)99-46-04 Барнаул (3852)73-04-60 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31

Подробнее

ПУСКО-ЗАРЯДНЫЕ УСТРОЙСТВА

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ ПУСКО-ЗАРЯДНЫЕ УСТРОЙСТВА STRIKER 540, 580, 900, 950, 1200 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72

Подробнее

ГАЗОВЫЕ ГЕНЕРАТОРЫ GE 3000, 5000, 6000, 6000T, 7000, 7000T

ПРОИЗВОДСТВО ГАЗОВОГО ОБОРУДОВАНИЯ ГАЗОВЫЕ ГЕНЕРАТОРЫ GE 3000, 5000, 6000, 6000T, 7000, 7000T ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Калининград

Подробнее

Электронный гигрометр ИВГ-1 К-П

Электронный гигрометр ИВГ-1 К-П переносной измеритель микровлажности однострочный ЖК индикатор интерфейс связи с компьютером RS-232 внутренняя память до 9000 точек Базовый комплект: ИВГ-1 К-П (измерительный

Подробнее

Уникальная франшиза интернетмагазина

Уникальная франшиза интернетмагазина постельного белья Готовый интернет-магазин Суть франшизы в том, что вы получаете рабочий, современный магазин, уже наполненный товарами. Мы обучаем работе с магазином,

Подробнее

сайт: эл. почта:

сайт: www.cztt.nt-rt.ru эл. почта: [email protected] Назначение Точный учет электрической энергии требует новых встроенных трансформаторов тока высоких классов точности. Существует ряд проблем широкого использования

Подробнее

ЛАБОРАТОРНАЯ МЕБЕЛЬ СТОЛЫ СЛП-1, СЛП-10, СЛП-11, СЛП-2-1, СЛП-2-2, СЛП-3, СЛП-4, СЛП-5-1, СЛП-5-2, СЛП-6-1, СЛП-6-2, СЛП-7, СЛП-8-1, СЛП-8-2, СЛП-9

ЛАБОРАТОРНАЯ МЕБЕЛЬ СТОЛЫ СЛП-1, СЛП-10, СЛП-11, СЛП-2-1, СЛП-2-2, СЛП-3, СЛП-4, СЛП-5-1, СЛП-5-2, СЛП-6-1, СЛП-6-2, СЛП-7, СЛП-8-1, СЛП-8-2, СЛП-9 По вопросам продаж и поддержки обращайтесь: Архангельск

Подробнее

ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ. По вопросам продаж и поддержки обращайтесь:

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ АККУМУЛЯТОРНЫЕ ШУРУПОВЕРТЫ 1112 B1A, 1112 K2N, 1112 K2NS, 1114 K2N, 1118 K2N, 1228 K2, 1422 K2, 1424 K2, 1428 K2, 1712 B1, 1712 K1, 1720 K2, 1722 K2, 1724

Подробнее

Циркуляционные насосы серии IP 50

Архангельск (1) 9 7 Астана +7(717)77 1 Белгород (7) Брянск ()59 5 Владивосток ()9 1 Волгоград ()7 Вологда (17) 1 59 Воронеж (7) 51 7 Екатеринбург () 55 9 Иваново (9)77 Ижевск (1) 5 Казань () 1 По вопросам

Подробнее

Технические характеристики

GARDEN SCOUT Технические характеристики Навесное оборудование Лопата-отвал мотоблочная По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана (7172)727-132 Астрахань (8512)99-46-04

Подробнее

Тип

Манометр Тип 404312 www.jumo.nt-rt.ru По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31

Подробнее

Сайт:

АГАТ 4-4.5.100 – Трехфазный многотарифный Имеет интерфейс «цифровой» и предусмотрен для работы в составе АСКУЭ. Счетчик оснащен интерфейсом связи IRDA. Счетчики крепятся на три винта. Все многотарифные

Подробнее

КАЛИБРОВОЧНЫЕ ГИРИ 100Г, 1КГ, 200Г, 2КГ, 3КГ, 500Г, 5КГ. По вопросам продаж и поддержки обращайтесь:

КАЛИБРОВОЧНЫЕ ГИРИ 100Г, 1КГ, 200Г, 2КГ, 3КГ, 500Г, 5КГ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Калининград (4012)72-03-81 Нижний Новгород (831)429-08-12 Смоленск (4812)29-41-54

Подробнее

Культиваторы HYUNDAI

Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31 Волгоград (844)278-03-48 Волог (8172)26-41-59 Воронеж (473)204-51-73 Екатеринбург

Подробнее

БЕНЗИНОВЫЕ ГЕНЕРАТОРЫ

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ БЕНЗИНОВЫЕ ГЕНЕРАТОРЫ 2302N, 2802N, 2200, 2201, 2202, 2801, 2802, 2203 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ По вопросам продаж и поддержки обращайтесь: Архангельск

Подробнее

Аппараты лазерной терапии серии «Матрикс»

Аппараты лазерной терапии серии «Матрикс» Разобраться в комплектации трудно, но есть всё же четыре стандартных комплекта: 1) Матрикс-физиотерапевт (2 канала) 2) Матрикс-косметолог (4 канала) 3) Матрикс-физиотерапевт

Подробнее

ПАСПОРТ ИЗДЕЛИЯ RAPAN-100 исп.v.8

ИСТОЧНИКИ ВТОРИЧНОГО ЭЛЕКТРОПИТАНИЯ РЕЗЕРВИРОВАННЫЕ ПАСПОРТ ИЗДЕЛИЯ RAPAN-100 исп.v.8 По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64

Подробнее

ЛИЧНЫЙ КАБИНЕТ АРМ “РЕСУРС”

По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток (423)249-28-31 Волгоград (844)278-03-48 Вологда (8172)26-41-59

Подробнее

Настроения экономики. Итоги июля 2014 года.

Настроения экономики. Итоги июля 2014 года. Оценка перспектив экономического роста в России По большей части экономические настроения населения остались на июньском уровне. Обстановка остается нестабильной.

Подробнее

ЭЛЕКТРИЧЕСКИЕ ТРИММЕРЫ

ЭЛЕКТРОИНСТРУМЕНТЫ И СТРОИТЕЛЬНОЕ ОБОРУДОВАНИЕ ЭЛЕКТРИЧЕСКИЕ ТРИММЕРЫ 8100, 8101, 8102, 8102 P, 8103, 8104, 8105, 8105 S, 8106, 8107, 8114, 8119, 8117, 8115, 8109 P, 8120, 8121, 8124, 8125 ТЕХНИЧЕСКИЕ

Подробнее

Трехфазные однотарифные счетчики

Трехфазные однотарифные счетчики АГАТ 3-1.5.0 Трехфазный однотарифный К1 с креплением на три винта. Счетчик содержат в качестве счетного механизма точности 1, ток 7,5 А, номинальное напряжение 3х220/380В.

Подробнее

КАРДИОТРЕНАЖЕРЫ ЭЛЛИПТИЧЕСКИЕ ТРЕНАЖЕРЫ X6-FR, X6-E, X4-E, 9900E, 8800E, E800 ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ. По вопросам продаж и поддержки обращайтесь:

КАРДИОТРЕНАЖЕРЫ ЭЛЛИПТИЧЕСКИЕ ТРЕНАЖЕРЫ X6-FR, X6-E, X4-E, 9900E, 8800E, E800 ТЕХНИЧЕСКИЕ По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Калининград (4012)72-03-81 Новосибирск (383)227-86-73

Подробнее

сайт: почта:

TKH-MOUSE-IND-SCROLL–BLACK-LASER- Особенности исполнения лазерная 116 х 62 х 38,6 мм 1000 dpi алюминиевое основание чѐрный 0.21 кг По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72

Подробнее

Виброплиты. MS60-3, MS60-4, MS90-1, MS90-3, MS90-4, MS125-4, MSh260-1, MSh260-3, MSh260-4, MS По вопросам продаж и поддержки обращайтесь:

Виброплиты. MS60-3, MS60-4, MS90-1, MS90-3, MS90-4, MS125-4, MSh260-1, MSh260-3, MSh260-4, MS330-3. По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород

Подробнее

сайт: эл. почта:

Панельные компьютеры. Серия 2 Технические характеристики По вопросам продаж и поддержки обращайтесь: Архангельск (8182)63-90-72 Астана +7(7172)727-132 Белгород (4722)40-23-64 Брянск (4832)59-03-52 Владивосток

Подробнее

Лаборатория блонд. Matrix – презентация онлайн

Творческая ЛАБОРАТОРИЯ – Blond
История MATRIX Наследие сильных
1980
Знай, Верь,
Мечтай, Дерзай
Arnie Miller
1932-1992
Осветление – это процедура изменения уровня тона светлее первоначального на один тон и
выше.
Осветление естественным путем – это воздействии солнечных лучей на волосы.
Незначительная степень осветления может быть получена при использовании перманентных
красителей или кратковременного воздействия мягкой формулы на основе осветляющей пудры.
Высокая степень осветления – обесцвечивание.
Для получения данного результата, как правило, используются осветляющие пудры.
Осветление волос — это удаление искусственного и/или натурального пигмента.
Осветление может быть как завершенным процессом , так и подготовительным для
дальнейшего окрашивания в желаемый оттенок.
Осветление-
плавный, контролируемый процесс
изменения уровня тона в сторону свет
Обесцвечиваниеинтенсивный процесс
удаления цветовых
пигментов из волос
Блондированиекомплексная услуга для
создания оттенка Блонд,
которая может включать в
себя: осветление,
мелирование,
обесцвечивание и
тонирование на выбор
мастера.
Нейтрализация
УРОВЕНЬ ТОНА-ФОН ОСВЕТЛЕНИЯ-НЕЙТРАЛИЗАЦИЯ
ФОН ОСВЕТЛЕНИЯ
ЦВЕТ ,НЕЙТРАЛИЗУЮЩИЙ
ФОН ОСВЕТЛЕНИЯ
Темный
Краснокоричневый
Темнозеленый
Темный
Краснокоричневый
Темно –
зеленый
Краснокоричневый
Зеленый
Красный
Зеленый
Краснооранжевый
Зеленосиний
Оранжевый
Синий
Оранжевожелтый
Желтооранжевый
Желтый
Синефиолетовый
Фиолетовосиний
Фиолетовый
Светло
желтый
Светлофиолетовый
Уровни тона
Оч. оч. свет.
блонд.
Оч. светлый
блондин
Фон осветления
10
Светложелтый
9
Желтый
Светлый
блондин
8
Желтооранжевый
Блондин
7
Оранжевожелтый
Тёмный
блондин
6
Светлый
шатен
5
Шатен
Тёмный
шатен
Черный
4
Оранжевый
Краснооранжевый
Красный
3
Темно -красный
2
Темно -красный
Продукты для
создания Блонд

11. Продукты для создания Блонд

УНИКАЛЬНЫЕ ВОЗМОЖНОСТИ:
Лайт Мастер –
это классическая осветляющая пудра с
ухаживающим Пантенолом
•увлажняет и сохраняет структуру волоса
во время воздействия пудры
. Основа -Перосульфаты
– Осветляет до 8 уровней тона
– Работает со всеми % оксидантов
12% без контакта с кожей головы
– Выбор соотношения % оксиданта и
пропорции смешивания влияет на
скорость осветления
Осветление
1ложка (15гр) Лайт Мастер
+ 30 мл Крем – Оксиданта MATRIX
Мелирование
2 ложки (30гр) Лайт Мастер
+ 45 мл Крем – Оксиданта MATRIX
Время выдержки до 50 минут
ПРИМЕНЕНИЕ
Крем – оксидант Matrix
Пропорции
смешивания
Время выдержки
Подходит для техники балеяж и для
любых техник без контакта с кожей
головы
Подходит для обесцвечивания,
мелирования и работы в контакте с
кожей головы
3%
6%
9%
12%
3%
6%
9%
1:1
1:2
15 гр порошка/15мл Ox Matrix
15 гр порошка/30мл Ox Matrix
До 50 минут при t° 22-24
Внимание!!! Не превышайте рекомендованное время выдержки, не накрывайте, не используйте тепло.
ПРИМЕНЕНИЕ
Услуга
Техника свободной
руки
Мелирование
Двойное нанесение
(корни – длина)
Пропорции
смешивания
Крем – оксидант
Matrix
Преимущество
1:1
3%,6%,9% или12%
Удобная текстура позволит
персонализировать окрашивание используя
технику балеяж и др.
1:1,5
3%,6%,9%
1:2
3%,6%,9%
Пластичная консистенция позволяет быстро
работать с фольгой
Благодаря нежной текстуре, продукт легко
распределяется от корней до кончиков
Внимание!!! Не превышайте рекомендованное время выдержки, не накрывайте, не используйте тепло.
Факторы, влияющие на степень осветления:
• количество нанесенной рабочей смеси на волосы;
• время выдержки рабочей смеси на волосах;
• выбранный % оксиданта;
• структура волос;
• температура, при которой протекает процесс осветления волос;
• продукт, который вы выбрали для этой цели.
Любая степень осветления волос — от легкого до полного обесцвечивания — воздействует
на структуру волос. Волосы к своему первоначальному состоянию уже не возвращаются.
Осветляющая пудра
2 Промоутера
4 Тонера
COLORGRAPHICS® PROMOTER
Промоутер № 8 Осветление до 4
уровней тона
2,4 % перекиси водорода
Промоутер № 22 Осветление до 6
уровней тона
6,6 % перекиси водорода
Применение разных ​Промоутеров,
с различными тонерами может дать вам неограниченные творческие возможности!
Как всегда, результаты будут зависеть от состояния, структуры и цвета волос
клиента. Не наносить на ранее обесцвеченные волосы.
Экстра –Холодный
Смягчает оранжевые нотки
фона осветления
Нейтральный
Балансирует нейтральные
тона.
Для натуральных прядей, эффект
выгоревших на солнце волос.
Холодный
Смягчает желтые нотки фона
осветления
Тёплый
Подчеркивает теплый фон
осветления .
Для клубничных блондинок.
Осветляющая пудра
2 части
Тонер
+ 2 части
Промоутер
+
1 часть
Эти три продукта выступают в качестве эффективной осветляющей системы
с кондиционирующим компонентом –Провитамин В5.
• Время: 2-10 минут с теплом (
Или до 50 минут при комнатной
температуре.
• Периодически проверяйте, достигнут ли
желаемый уровень осветления .
• Смешивайте систему Color Graphics в
неметаллической посуде.
• Не заменяйте компоненты системы Color
Graphics Lift & Tone (Пудру , Промоутер,
Тонер) никакими другими продуктами.
• Используйте только рекомендованные
Промоутеры 8 (2,4%) или
22 (6,6%) .
• Не используйте другие оксиданты.
• ■ Не превышайте рекомендованное время
выдержки.
• Используйте сразу после смешивания.
• Использовать без контакта с кожей головы!
Колор Синк – многофункциональный краситель
без аммиака
Окрашивание волос тон-в-тон
Создание стойкого оттенка на
предварительно обесцвеченных волосах
Коррекция цвета
Синхронизация цвета
Восстановление цвета
Пастельное тонирование
Тонирование седины
Глубокое тонирование седины
Разбавление оттенка
Глазирование
+ 5 минут – для интенсивности оттенка
РЕНОВАЦИЯ Color Sync
#БОЛЬШЕ ЧЕМ ЦВЕТ
РЕНОВАЦИЯ Color Sync
РЕНОВАЦИЯ Color Sync
УПАКОВКА КАК ИНДИКАТОР ИННОВАЦИОННОЙ
ФОРМУЛЫ
ПАЛИТРА COLOR SYNC
БЕЗАММИАЧНАЯ ФОРМУЛА: 59 оттенков , 14
абсолютных новинок
NEW Color Sync: ВОЗМОЖНОСТИ
ОТКРОЙТЕ ДЛЯ СЕБЯ МИР
ПРОДУКТОВ MATRIX ДЛЯ ОКРАШИВАНИЯ ВОЛОС
SOCOLOR.beauty
Гладкость
Защитно-ухаживающий комплекс
Запатентованный Cera-Oil Complex
• придает волосам блеск
• обеспечивает долговременный
современный уход.
Cera-Oil Complex в действии:
HexaForce Полимер – Укрепляет и
защищает кутикулу и кортекс
Сила
Керамиды – выравнивают пористые
участки волоса
Re-surfacing полимер – Придает кутикуле
гладкие смягчающие свойства увеличивая
плотность волоса
Cera-Oil Complex
Масло Жожоба – Питает и создает гладкую
блестящую поверхность .
СПЕЦИАЛЬНАЯ КОЛЛЕКЦИЯ ОТТЕНКОВ БЛОНД
Консистенция Stay Put application – идеально для мелирования!
Re-surfacing полимер – придает кутикуле гладкие смягчающие свойства,
увеличивая плотность волоса
Нейтрализует и поднимает в 1 простой шаг, блокирует нежелательные оттенки.
Пропорции смешивания 1:2 Крем – Оксидант MATRIX
Время выдержки : 50 минут без применения тепла
9% 30V или 12%/40V
СПЕЦИАЛЬНАЯ КОЛЛЕКЦИЯ ОТТЕНКОВ БЛОНД
UL-A+ – Пепельный+
UL-P- Жемчужный
UL-V+ – Перламутровый+
UL-VV- Глубокий Перламутровый
UL-NV+ – Натуральный Перламутровый+
UL-N – Натуральный
UL-N+ – Натуральный +
UL-M – Мокка
Преимущества оттенка CLEAR
1. 1 оттенок – 3 услуги в салоне
2. Использование CLEAR позволяет расширить палитру блонд
за счет создания пастельных оттенков
3. CLEAR делает возможным осветление натуральных волос до
4 уровней тона, при этом действует мягче любых других
осветляющих средств
4. Добавление равного количества прозрачного оттенка CLEAR
к любому оттенку SOCOLOR.beauty разбавит интенсивность
цвета до 1 уровня тона, что позволит получить оттенки,
которых нет в палитре SOCOLOR.beauty
MUS
T
HAV
E
1 ОТТЕНОК = 3 УСЛУГИ В САЛОНЕ
СИНХРОНИЗАЦИЯ ОТТЕНКА
МЕРЦАЮЩИЕ
ПРЯДИ
Услуга позволяет быстро
сделать невидимым
контраст между
натуральными
и осветленными волосами
Услуга позволит создать
многомерные пряди за
счет мягкого воздействия
продукта на натуральный
пигмент
Пропорции смешивания:
1:1 с крем-оксидантом
MATRIX 6%, 9%, 12%
Время выдержки: 10 минут
Пропорции смешивания:
1:1 с крем-оксидантом
MATRIX 3%, 6%, 9%, 12%
Время выдержки: 35-45
минут
ПАСТЕЛЬНЫЕ ОТТЕНКИ
Услуга позволяет создать
мягкие пастельные оттенки
на осветленных волосах
путем смешивания с
другими оттенками
SOCOLOR.beauty.
Пропорции смешивания:
1:1 с крем-оксидантом
MATRIX 3%,
Время выдержки: 10 минут
Рецепты создания пастельных оттенков с CLEAR
Рецепты создания пастельных оттенков с CLEAR
Рецепты создания пастельных оттенков с CLEAR
УНИВЕРСАЛЬНЫЙ БУСТЕР ДЛЯ
SOCOLOR BEAUTY И COLOR SYNC
Не ограниченное количество креативных цветовых решений
Усиление оттенка и нейтрализация
Усиливает интенсивность и яркость:
КРАСНЫЙ – красные, медные, фиолетовые и коричневые оттенки
МЕДНЫЙ – медные, красные и коричневые оттенки
ЖЕЛТЫЙ – золотистые, медные, оттенки
СИНИЙ – холодные, фиолетовые, коричневые оттенки
УНИВЕРСАЛЬНЫЙ БУСТЕР ДЛЯ
SOCOLOR BEAUTY И COLOR SYNC
SOCOLOR beauty 45 мл + SOBOOST до 15 мл + 60 мл крем- оксидант
•Работает со всеми крем-оксидантом MATRIX 3%, 6%, 9%, 12%
•Время выдержки зависит от используемого красителя.
Пример: 45 мл Sc.b 6А +15 мл SOBOOST+ 60 мл крем- оксидант MATRIX.
COLOR SYNC 45 мл + SOBOOST до 15 мл + 60 мл активатор COLOR SYNC .
Пример:15 мл CS Cler +5 «горошин» SOBOOST синий +
15 мл. активатор COLOR SYNC
Рецепты создания пастельных оттенков с CLEAR
Знай, Верь,
Мечтай, Дерзай !!!

Пятновыводитель Matrix Pro Backbar No Stain Color

Что это такое
Высококонцентрированные формулы, разработанные для удовлетворения наиболее распространенных потребностей при окрашивании и химическом обслуживании.
Что он делает
No Stain удаляет пятна краски для волос на линии роста волос, ушах и коже головы клиента. Быстро, легко и эффективно с помощью средств для окрашивания волос. Эта формула не оставляет остаточной пленки.
Что еще вам нужно знать

• Удаляет окрашенный цвет

• Не раздражает

• Пост-яркое окрашивание

• Постсерое покрытие

• Можно использовать для кожи головы, ушей и линии роста волос

 

• Сразу после завершения окрашивания аккуратно протрите испачканные участки ватой, смоченной No Stain.

• Если кожа головы окрашена после того, как краска была обработана и смыта, нанесите средство No Stain с помощью ваты и осторожно промокните.

• Промойте участки после нанесения.

• Используйте для удаления пигментов Color Blow Dry с инструментов путем смешивания 1 части No Stain с 3 частями воды и 1 дозой желаемого шампуня.

• При необходимости смешайте раствор и замочите инструменты.

АКВА / ВОДА / EAU • ГЕКСИЛЕНГЛИКОЛЬ • СПИРТ ДЕНАТ.• ДИПРОПИЛЕНГЛИКОЛЬ • ПАРФЮМ/АРОМАТ • ОЛЕИНОВАЯ КИСЛОТА • ТЕТРАНАТРИЙ ЭДТА • АММОНИЙ ГИДРОКСИД

Рейтинг 5 из 5 к ДжоДжо из Хорошо работает, сокращает одноразовые отходы Пятно удаляет хорошо.Мне нравится, что вы можете положить его на полотенце, чтобы использовать вместо других одноразовых одноразовых салфеток.

Дата публикации: 2021-12-16

Оценка 1 из 5 к сеньорита Соне из сажа, но ничего хорошего Обычно большинство пятновыводителей работают далеко, некоторые лучше, чем другие, но это вообще не удаляло пятно, я терла лоб клиента, как сумасшедшая, я даже оставила вату на 2 минуты, просто дала впитаться, но все еще вижу тень… Я нанесла много защитного крема, поэтому должно было легко оторваться, теперь нужно купить новый пятновыводитель.

Дата публикации: 2021-11-29

Рейтинг 5 из 5 к Nic4 от Пока пятна Этот продукт отлично справляется с удалением цвета вокруг лица. Я заметил, что со всей маской цвет становится повсюду, и этот продукт делает свое дело и не раздражает кожу клиентов.

Дата публикации: 06.11.2021

Рейтинг 5 из 5 к Кейси1 из Волшебный ластик Это прекрасно работает! Оттирать тоже много не надо.

Дата публикации: 06.11.2021

Рейтинг 5 из 5 к Солнышко от Никаких пятен! Этот пятновыводитель работает отлично – все следы цвета моих волос на моей коже были очень легко удалены с помощью этого продукта. Я определенно рекомендую этот.

Дата публикации: 31.10.2021

Рейтинг 5 из 5 к Брай1 из Отличная предварительная химическая обработка Мне нравится использовать это перед моими клиентами по деколонизации и химическому обслуживанию.Я получаю лучший подъем, насыщенность цвета и яркость!

Дата публикации: 31.10.2021

Рейтинг 5 из 5 к Марлемарр из Тройная угроза Мне прислали эти продукты, и мне нравится, как они работают. Они прекрасно пахнут и действительно работают!

Дата публикации: 27.10.2021

Оценка 4 из 5 к Adrielfdz89 от Без пятен, и точка!! Это отличное средство после окрашивания, очень легко удаляет все следы.Не очень приятный запах, но он работает очень хорошо!

Дата публикации: 27.10.2021

Matrix представляет новые профессиональные продукты » EsteticaMagazine.com

Matrix объявляет о выпуске новых профессиональных продуктов ProSolutionist Backbar Heroes: InstaCure, осветляющего шампуня Alt Action и No Stain для профессионалов, которые решают проблемы с пористостью, накоплением и окрашиванием.

Кроме того, Matrix приветствует SoColor и SoColor Sync Pre-Bonded Extra Coverage с защитой волокна и 100% закрашиванием седины.Формулы теперь предварительно связаны с эксклюзивным защитным концентратом для защиты внутренней структуры волос, цвет за цветом и предварительно смешаны с коричневым / бежевым фоном.

  • Matrix Instacure, Alt Action и No Stain
  • Matrix SoColor и SoColor Sync Pre-Bonded Extra Coverage

MATRIX INSTACURE, ALT ACTION AND NO Stain

Matrix всегда пользовался успехом у парикмахеров благодаря наиболее эффективным и простым в использовании формулам для профессиональных услуг.Сегодня система поддержки Matrix для стилистов мощнее, чем когда-либо, благодаря новой улучшенной коллекции ProSolutionist. Эти три продукта «только для профессионалов» помогут каждому стилисту стать героем для своих клиентов:

  • Instacure: Каждый специалист по волосам знает, что пористость является злейшим врагом окрашивания и перманентного текстурирования волос. Чрезмерно пористые волосы могут привести к слишком быстрому выцветанию цвета, слишком быстрому выпадению локонов, неравномерному распределению цвета, а также к завивке и ломкости волос.Пористость возникает, когда кутикула на поверхности пряди волос повреждена или приподнята, что ослабляет волокно волоса. Instacure — профессиональный спрей, который устремляется к поврежденным участкам каждого волоска, разглаживая кутикулы и выравнивая чрезмерную пористость прядей. Instacure наносится во время химической завивки или окрашивания, а также может использоваться в качестве несмываемого средства перед укладкой, чтобы уменьшить пушистость и статическое электричество.
  • Осветляющий шампунь Alt Action: Эта гелевая формула для глубокого очищения осветляет волосы, удаляя грязь и грязь, не удаляя натуральные масла с волос и не раздражая кожу головы.Стилисты полагаются на Alt Action для подготовки волос к услугам по коррекции цвета, релаксации и текстурированию. Он также идеально подходит для исправления грязных тонов, шелушения кожи головы и ошибок при окрашивании. №
  • No Stain: Быстро и бережно удаляет краску с кожи, устраняя все следы случайного окрашивания, которые могут возникнуть при окрашивании. No Stain удаляет естественные и модные оттенки, не раздражая кожу. Его можно использовать на коже головы, ушах и линии роста волос.

Каждая из этих высококонцентрированных формул была разработана для удовлетворения наиболее распространенных потребностей при окрашивании и химическом обслуживании.

MATRIX SOCOLOR И SOCOLOR SYNC ПРЕДВАРИТЕЛЬНО БОНДИРОВАННОЕ ДОПОЛНИТЕЛЬНОЕ ПОКРЫТИЕ

Новые инновационные формулы SoColor и SoColor Sync Extra Coverage от Matrix теперь предварительно связаны с эксклюзивным защитным концентратом для защиты внутренней структуры волос, цвет за цветом. Эти перманентные и полуперманентные оксидативные красители идеально подобраны друг к другу, поэтому профессионалы могут добиться бесшовного, стойкого цвета от корней до кончиков, который держится и исчезает в зависимости от тона с дополнительным покрытием, которое покрывает до 100% седины, предварительно смешанной с коричневым / бежевым фоном. .

Ключевые преимущества:

  • Эксклюзивный концентрат для защиты бонда состоит из уникальной смеси таурина и катионных полимеров, которые действуют как внутренняя система поддержки бонда в процессе окрашивания
  • До пяти уровней осветления за 45 минут для дополнительного покрытия

Для после уход, используйте соответствующие коллекции Matrix Total Results (So Silver, Brass Off, Keep Me Vivid, Dark Envy, Unbreak My Blonde) для поддержания ярких оттенков цвета и здоровья волос.

Матрица распространения побочных эффектов | Документация FlowJo

Матрица распространения вторичных эффектов (SSM) доступна в редакторе компенсации.

Этот инструмент работает только с матрицами, рассчитанными с помощью Мастера компенсации FlowJo. Невозможно рассчитать SSM для матриц компенсации, рассчитанных заранее.

 

Чтобы сгенерировать матрицу распространения перелива в FlowJo, зайдите в редактор компенсаций, выберите интересующую матрицу и нажмите там кнопку «SSM»:

 

Побочное распространение интерпретируется как помеха для сигнала, обнаруживаемого над фоном, и является неотъемлемой частью конфигурации данного прибора.Распространение перелива для данной пары детектор/переход-цвет можно рассчитать эмпирически, взяв квадратный корень из различий в квадратах робастных стандартных отклонений измеренной интенсивности флуоресценции от неокрашенных отрицательных и однократно окрашенных положительных контрольных популяций:

 

Где:

  • R означает «Эталон», что означает популяцию FL2 в этом примере
  • S означает «окрашенный», что означает популяцию FL2+ в этом примере
  • Sigma – это стандартное отклонение (с поправкой на использование 84-го и 50-го процентилей)
  • F – флуоресценция в единицах интенсивности

Эти значения могут быть рассчитаны для каждой пары окрашивания детекторов, в результате чего получается матрица распространения перелива.Значения в этой матрице не являются процентами, а представляют собой стандартное отклонение распространения, также известного как распространение сигнала. Значения в этих матрицах непосредственно сопоставимы, хотя они описывают только одну часть сложной системы, которая влияет на качество панели потоков.

 

Контроль качества чувствительности прибора. Поскольку распространение сигнала напрямую влияет на чувствительность канала, а результаты между машинами с одинаковой конфигурацией легко сопоставимы, SSM можно использовать в качестве эталона для контроля качества конфигурации и производительности.

Оптимизация панели. Конструкция панели иммунофлуоресценции становится все более сложной по мере того, как исследователи используют все больше каналов обнаружения в своих экспериментах. Расчет SSM помогает указать способ максимизации полезного сигнала.

Сравнение различных конфигураций приборов. Измерение дает менеджеру PI или SRL возможность количественно сравнивать разные цитометры и/или альтернативные конфигурации данного цитометра.

 

Каталожные номера:

  1. Нгуен, Перфетто и др.Количественная оценка распространения побочных эффектов для сравнения производительности инструментов и помощь в проектировании многоцветных панелей». Цитометрия А. 2013.

 

Если у вас есть какие-либо вопросы о функции матрицы распространения перелива или компенсации в целом, обратитесь к инженерам по приложениям FlowJo: [email protected]

Метки: FlowJo

Matrix Total Results Pro Solutionist No Stain 237 мл – Склад в Салоне

The Matrix Total Results Pro Solutionist No Stain — идеальное решение для удаления пятен краски для волос с кожи.Этот продукт поставляется в бутылке объемом 237 мл.
The Matrix Total Results Pro Solutionist No Stain имеет уникальную формулу, которая мягко удаляет пятна краски для волос с кожи после окрашивания. Средство Matrix Total Results Pro Solutionist No Stain лучше всего подходит для удаления брызг и пятен с кожи головы. Он не только удаляет пятна краски для волос на коже головы, но также удаляет пятна на ушах и линии роста волос. Matrix Total Results Pro Solutionist No Stain — быстродействующий продукт. Он предназначен для удаления цветных пятен, и самое приятное то, что он не оставляет остаточной пленки после нанесения.Двигаясь дальше, вот лучшие функции Matrix Total Results Pro Solutionist No Stain.
Идеальный продукт для удаления пятен краски для волос с кожи
The Matrix Total Results Pro Solutionist No Stain выпускается во флаконе объемом 237 мл. Обработка цвета
Этот продукт идеально подходит для удаления брызг и пятен на коже головы
Удаляет пятна краски для волос на коже головы, в ушах и по линии роста волос
The Matrix Total Results Pro Solutionist No Stain является быстродействующим продуктом
Работает с целенаправленным удалением цветных пятен
It не оставляет остаточной пленки на волосах после нанесения
Теперь, вот инструкции по применению Matrix Total Results Pro Solutionist No Stain.
После того, как вы закончите нанесение цвета, сразу же нанесите средство Matrix Total Results Pro Solutionist No Stain
Аккуратно протрите загрязненные участки влажной ватой с этим продуктом
Если кожа головы окрашена после обработки и смывания краски, нанесите Matrix Total Results Pro Solutionist Нет Окрашивайте ватой и осторожно промокните
Промойте участки после нанесения Matrix Total Results Pro Solutionist Нет Окрашивайте
Не глотайте и храните в недоступном для детей месте
Если Matrix Total Results Pro Solutionist Нет Пятно попало в глаза, немедленно промойте глаза

Представляем новую линейку задних стержней от Matrix

Рекламный контент

от charlottegw / последнее обновление 21 февраля 2022 г.

Заставьте область обратной промывки работать на вас с помощью четырех новых продуктов Backbar для Matrix, включая новый главный продукт, спрей для нейтрализации пористости InstaCure.Согласно недавнему исследованию*, 52% клиентов ищут дополнительные услуги для поддержания видимого здоровья своих волос, а 36% предпочитают тонирование.

Четыре продукта, предназначенные для подготовки, заполнения, редактирования и питания типов волос, были обновлены, но с великолепными формулами, которые полюбились парикмахерам от Matrix. Теперь решение любых дилемм на обратной промывке еще никогда не было таким простым.

И продолжайте читать статью до конца, чтобы узнать больше о конкурсе Matrix Backbar Hero, в котором вы можете выиграть пакет обучения и ключевых продуктов, любезно предоставленных брендом! Дата закрытия — 21 марта 2022 года — так что участвуйте прямо сейчас!

Подготовка

Alt Action – Очищающий шампунь с гелевой формулой очищает волосы, удаляя остатки продукта и освежая их.

Заполнение

Insta Cure — герой серии, этот спрей для сглаживания пористости содержит протеины пшеницы. Эта легкая формула воздействует на чувствительные и уязвимые волосы, помогая выровнять пористость и разгладить кутикулу. Идеально для подготовки волос к тонированию. Instacure помогает создать ровную поверхность для цветных приложений.

Редактировать Пятновыводитель No Stain — Hair Color Stain Remover — это быстрая, простая и эффективная кнопка отмены для колористов.Эта формула помогает удалить цветные пятна с кожи и может быть использована на ушах, линии роста волос и коже головы. (Хотите вдохновиться цветовым трендом , любезно предоставленным Matrix? Взгляните на это!)

Питание

Total Treat – Rich Cream Mask – это интенсивно питательная процедура, которая балует сухие, поврежденные волосы, делая их роскошно увлажненными и кондиционированными всего за пять минут.

Цены:
Альтернативная акция £14.50/ € 19,00
Instacure £10,00/€ 11,50
No Stain £10,00/€ 11,50
Total Treat £14,50/€ 19,00  

 

Соревнование незамеченных героев HJ X Matrix!

Чтобы отпраздновать запуск линейки и своего героя , Matrix ищет сообщество парикмахеров, чтобы номинировать своих невоспетых героев. От помощников, без которых вы не можете жить, до стилистов, которые сделали все возможное, назовите (1) название парикмахерской, (2) причину, по которой кто-то, работающий в этом салоне, заслуживает награды (не называя человека!) и (3) используйте хэштег #MatrixUnsungHero.Дата закрытия – 21 марта 2022 года, и победитель получит пакет из образования и ключевых продуктов, любезно предоставленных Matrix. (Пожалуйста, ознакомьтесь с Минимальными условиями** ниже). В состав судей войдут посол Великобритании и Ирландии Лиза Фарролл, художник Matrix Десмонд Мюррей, президент Fellowship for British Hairdressing Кен Пиктон и редактор HJ Шарлотта Грант-Уэст.

Чтобы узнать больше, подпишитесь на @Matrix в Instagram и посетите www.matrixhaircare.co.uk

Это спонсируемый пост в сотрудничестве с Matrix.

**Минимальные условия

резидентов Великобритании и ROI только в возрасте 16+. Заявки принимаются с 09:00 (по британскому времени) 21 февраля 2022 г. до 23:59 (по британскому времени) 21 марта 2022 г. Чтобы получить шанс увидеть, как ваш невоспетый герой из салонного профессионального мира получает приз, укажите (1) имя парикмахерской, (2) причина, по которой кто-то, работающий в этом салоне, заслуживает приза (без имени человека) и (3) использовать хэштег #MatrixUnsungHero в ответ на вопрос «Матрица ищет невоспетых героев промышленность.Кто-то, кто сделал все возможное в салоне или в сообществе, – прокомментируйте ниже название салона и почему кто-то в этом салоне заслуживает победы», когда он появится на странице Instagram журнала парикмахеров по адресу https://www.instagram. com/hairdressersjournal/?hl=en или страницу журнала Hairdressers Journal в Facebook по адресу https://www.facebook.com/HairdressersJournal. Будут выбраны 4 победителя. Один из них выиграет индивидуальную образовательную сессию в собственном салоне с одним из четырех художников, а также средства для ухода за волосами и укладки Matrix на сумму 250 фунтов стерлингов (включая четыре новых продукта Backbar).Трое других победителей получат средства по уходу за волосами и укладке Matrix на сумму 150 фунтов стерлингов (включая четыре новых продукта Backbar). Работы-победители будут выбраны жюри, которое ищет кого-то, кто вышел за рамки своей работы в салоне и обществе, работая со своими клиентами, поддерживая свою команду или занимаясь благотворительностью. Полные условия здесь. Промоутеры: Matrix, торговое подразделение L’Oréal (UK) Limited, 255 Hammersmith Road, London W6 8AZ, и Hairdressers Journal, издание M Squared Media Limited, Allington House, 25 High Street, Wimbledon SW19 5DX.

* UKI L’Oréal Category Scan, 2020

Получайте больше новостей парикмахерского искусства, советов и эксклюзивных конкурсов прямо на свой почтовый ящик

ЗАРЕГИСТРИРОВАТЬСЯ

Трехфакторная неотрицательная матричная факторизация на основе разделения красителей HE в гистопатологических изображениях

Journal of Ambient Intelligence and Humanized Computing (2021) 12:6505–6513

ОРИГИНАЛЬНОЕ ИССЛЕДОВАНИЕ

Трехфакторная неотрицательная матричная факторизация на основе окрашивания HE

Несмешивание гистопатологических изображений

Mohamed-Yacin-Sikkandar1- T.Jayasankar2· K.R.Kavitha3· N.B.Prakash5· NatteriM.Sudharsan5·

G.R.Hemalakshmi6

Получено: 16 апреля 2019 г. / Принято: 16 апреля 2019 г. Июнь 2020 г. / Опубликовано онлайн: 11 июля 2020 г.

© Springer-Verlag GmbH Germany, часть Springer Nature 2020

Abstract

Гистологическое окрашивание облегчает микроскопическое изучение пораженных тканей в клинических исследованиях. Окрашивание флуоресцентными красителями

усиливает контраст ткани, выделяя важные признаки.Протокол окрашивания гематоксилином и эозином является наиболее распространенным в гистопатологическом анализе клеток и тканей при диагностике рака. Окрашивание HE обеспечивает визуальное представление

аномалий тканей, различая ядра клеток и ацидофильные структуры. Разделение красителя — не менее важная процедура, которая

разлагает многоцветное изображение на отдельные компоненты пятна. Эти компоненты необходимы для визуального исследования

взаимодействия между красителем и конкретными тканями.В этой рукописи предлагается оригинальный подход к обесцвечиванию клеток

, основанный на трехфакторной неотрицательной матричной факторизации, которая отделяет компоненты H и E от окрашенного HE изображения.

Экспериментальные результаты со стандартными наборами данных и показателями производительности демонстрируют надежность метода, обеспечивающего лучшие значения PSNR и SSIM для разделения пятен по сравнению с аналогичными работами в этом контексте. Значения PSNR около

30 дБ достигаются с помощью предложенного подхода с разделением, что составляет более 10 дБ по сравнению с эталонными подходами.

Точно так же значения SSIM получаются в диапазоне 0,42–0,73, что указывает на прочные структурные элементы. Предложенный метод

может быть дополнительно расширен для изучения взаимодействия других активаторов в процессе заживления ран при прогрессировании рака.

Ключевые слова Изображение окрашивания HE· Неотрицательная факторизация· PSNR· SSIM

1 Введение

Изучение гистопатологических изображений дает ценную информацию о биопсиях при лечении рака в различных

органах, таких как грудь, печень , легкие и т. д.Окрашивание образцов биопсии гематоксилином и эозином

(HE) является стандартным протоколом (Rubin

et al. 2008) при анализе и прогнозировании рака. Haema-

toxylin (H) представляет собой синий флуоресцентный краситель, который избирательно прилипает

к ядру биоптата-кандидата. Точно так же эозин (E) представляет собой

флуоресцентный краситель, окрашивающий цитоплазму и строму

* Mohamed Yacin Sikkandar

[email protected]

T. Jayasankar

[email protected]

KR KAVITHA

[email protected]

NB Prakash

[email protected]

Natteri M. sudharsan

[email protected]

GR Hemalakshmi

[email protected]

1 Кафедра технологий медицинского оборудования, Колледж

Прикладных медицинских наук, Университет Маджмаа,

Аль-Маджмаах 11952, Саудовская Аравия

2 Кафедра электроники и инженерии связи,

Университетский колледж Кампус BIT, Анна

Университет, Тиручираппалли, Тамилнаду, Индия

3 Факультет электроники и инженерии связи,

Технологический колледж Сона, Салем, Тамилнаду, Индия

4 Факультет электроники и инженерии,

Национальный инженерный колледж, К.R. Nagar, Kovilpatti,

Тамилнаду, Индия

5 Факультет машиностроения, Раджалакшми

Инженерный колледж, Килпак, Ченнаи, Тамилнаду, Индия

, KR Nagar, Kovilpatti, Tamilnadu,

India

Содержание предоставлено Springer Nature, применяются условия использования. Права защищены.

Экспрессия матриксной металлопротеиназы 9 (MMP9) в преэклампсии децидуальной оболочки и индукция MMP9 фактором некроза опухоли альфа и интерлейкином 1 бета в децидуальных клетках первого триместра человека1 | Биология репродукции

Аннотация

Экстраворсинчатые трофобласты (EVT) проникают в децидуальную оболочку человека посредством последовательного интегрин-опосредованного связывания и протеолиза белков базальной мембраны во внеклеточном матриксе (ECM).При преэклампсии неглубокая инвазия EVT нарушает ремоделирование спиральных артерий и артериол, уменьшая маточно-плацентарный кровоток. Избыток экспрессируемых децидуальными клетками матриксных металлопротеиназ (ММП) 2 и 9 в ответ на связанный с преэклампсией интерлейкин 1 бета (IL1B) и фактор некроза опухоли альфа (TNF) может неадекватно разрушать эти белки базальной мембраны и препятствовать инвазии EVT. Это исследование выявило значительно более высокие иммуногистохимические уровни MMP9 в децидуальных клетках и прилегающих интерстициальных трофобластах в срезах плаценты у женщин с преэклампсией по сравнению с контрольными женщинами того же гестационного возраста.Напротив, иммуноокрашивание на MMP2 и тканевые ингибиторы матриксных металлопротеиназ 1 и 2 (TIMP1 и TIMP2) были одинаковыми в преэклампсии и контрольной группе. Децидуальные клетки первого триместра инкубировали с эстрадиолом (E 2 ) или E 2 + ацетатом медроксипрогестерона (MPA), с TNF или IL1B или без них. Как было измерено с помощью ELISA, оба цитокина вызывали зависящее от концентрации повышение уровня секретируемого MMP9, на которое не влиял MPA. Напротив, уровни секретируемых MMP2, TIMP1 и TIMP2 не изменились во всех группах лечения.Зимография в субстратном геле и Вестерн-блоттинг подтвердили, что каждый цитокин повышал уровень секреции MMP9, но не MMP2. Точно так же количественная ОТ-ПЦР показала, что TNF и IL1B повышали уровни мРНК MMP9 , но не MMP2 . В месте имплантации MMP9, усиленный воспалительными цитокинами, может способствовать развитию преэклампсии, нарушая децидуальный внеклеточный матрикс и препятствуя нормальной ступенчатой ​​инвазии EVT.

Введение

Прогестерон трансформирует обработанные эстрадиолом (E 2 ) стромальные клетки эндометрия человека в децидуальные клетки в лютеиновой фазе менструального цикла и во время беременности [1, 2].Децидуализация включает преобразование интерстициального внеклеточного матрикса (ECM) фолликулярной фазы в перидецидуальный ECM, обогащенный компонентами типа базальной мембраны [3-5]. Вневорсинчатые трофобласты (EVT) проникают в децидуальную оболочку и затем прорывают ее капилляры, чтобы обеспечить эмбрион кислородом и питательными веществами до плацентации [6]. Впоследствии ЭВТ пересекают децидуальную оболочку и проникают в миометрий. Мигрирующие EVT проникают в спиральные артерии и артериолы и ремоделируют их [7, 8] для создания сосудов с низким сопротивлением и высокой емкостью, которые увеличивают приток крови к межворсинчатому пространству, необходимому для роста и развития фетоплацентарной единицы [8].

Инвазия децидуальной оболочки включает последовательное присоединение экспрессируемых EVT молекул адгезии, таких как интегрины (ITG) ITG альфа 1/ITG бета 1 и ITG альфа 5/ITG бета 1, которые распознают ламинин/коллаген IV и фибронектин, соответственно, в децидуальном ВКМ [3, 4, 9], а также эндотелиальный кадгерин сосудов, рецептор эндотелиальных клеток [10]. Дисрегуляция экспрессии молекул децидуальной адгезии связана с неглубокой инвазией EVT и неполной сосудистой трансформацией [11].В результате сниженный маточно-плацентарный кровоток вызывает гипоксию плаценты [12] и секретирует в материнский кровоток несколько предполагаемых индукторов активации эндотелиальных клеток и повреждения сосудов (рассмотрено в Karumanchi and Bdolah [13] и Borzychowki et al. [14]). В конечном итоге развиваются артериальная гипертензия и протеинурия, признаки материнского синдрома [15, 16].

Состав децидуального ВКМ отражает баланс между синтезом нового белка базальной мембраны и экспрессией протеазы, разрушающей ВКМ.Матриксные металлопротеиназы (ММП) представляют собой семейство цинкзависимых протеаз, которые несут основную ответственность за расщепление большей части компонентов ВКМ. Члены этого семейства обычно классифицируются на основе субстратной специфичности и включают коллагеназы, которые опосредуют протеолиз фибриллярных коллагенов; стромелизины, которые могут разрушать чрезвычайно широкий спектр компонентов ECM и активировать зимогенную форму других MMP; и желатиназы, которые расщепляют денатурированные фибриллярные коллагены (желатины), а также белки, ассоциированные с базальной мембраной [17–19]. клетки и участвуют в обороте ECM [20-24].Среди ММР желатиназа А (ММР2) и желатиназа В (ММР9) преимущественно разрушают компоненты базальной мембраны [17, 18].

Изменяя оборот децидуального внеклеточного матрикса, аберрантная экспрессия децидуальными клетками MMP2 и/или MMP9 может способствовать преэклампсии, препятствуя ступенчатой ​​инвазии EVT, опосредованной молекулами адгезии. Провоспалительные цитокины интерлейкин 1 бета (IL1B) и фактор некроза опухоли альфа (TNF) связаны с различными аспектами преэклампсии [25–27]. Основные материнские инфекции в подмножествах случаев преэклампсии (рассмотрено в Sibai et al.[16]) и избыток децидуальных макрофагов в преэклампсии децидуальной оболочки [28–30] являются вероятными источниками этих цитокинов [31]. Решающая роль, которую играет прогестерон в поддержании беременности, побудила оценить эффекты IL1B и TNF с прогестином и без него на экспрессию MMP2 и MMP9 в децидуальных клетках первого триместра, основной тип клеток, встречающийся при вторжении EVT в место имплантации [32, 33]. . Эти исследования in vitro были дополнены иммуногистохимической локализацией MMP2 и MMP9 в децидуальной оболочке преэклампсии по сравнению с контрольными срезами плаценты того же гестационного возраста.

Материалы и методы

Салфетки

Для иммуногистохимических исследований плаценты и прикрепленные плодные оболочки были получены при неосложненных беременностях после кесарева сечения или вагинальных идиопатических спонтанных преждевременных родов (n = 11), а также при кесаревом сечении и вагинальных преждевременных родах с подозрением на преэклампсию (n = 11) после получения письменного информированного согласия в Больница Йель-Нью-Хейвен одобрена Следственным комитетом.Средний гестационный возраст ± SEM составил 30,5 ± 1,2 недели и 30,3 ± 1,0 недели для недоношенных контролей и случаев преэклампсии соответственно. Гестационный возраст пациенток контрольной группы и пациенток с преэклампсией статистически не отличался. Гестационный возраст оценивали по последней менструации и УЗИ в первые 20 недель беременности. Ни у одного из пациентов не было выявлено признаков децидуального кровоизлияния, хориоамнионита, хронического виллита или других признаков основного острого или хронического воспаления, определенных при гистологическом исследовании каждого образца.

Преэклампсия определялась стандартными критериями [34] как систолическое и диастолическое артериальное давление ≥140 мм рт.ст. и ≥90 мм рт.ст. соответственно, а протеинурия определялась как ≥0,3 г белка в 24-часовом сборе мочи, возникающая после 20 нед. беременности у женщины с ранее нормальным артериальным давлением. Тяжелая преэклампсия (8 из 11 пациенток) определялась как систолическое и диастолическое артериальное давление ≥160 мм рт.ст. и ≥110 мм рт.ст. соответственно в двух случаях с интервалом не менее 6 часов во время постельного режима и/или протеинурия ≥5 г в 24-часовой образец мочи или ≥300 мг/дл в двух случайных образцах мочи, взятых с интервалом не менее 4 часов.

Для клеточных культур образцы децидуальной ткани восьми неосложненных плановых абортов между 6 и 12 неделями беременности были получены с одобрения Институционального контрольного совета в больнице Bellevue (Нью-Йорк, штат Нью-Йорк). Децидуальную оболочку отделяли, небольшую ее часть фиксировали в формалине и заливали в парафин, а затем гистологически исследовали признаки основного острого и хронического воспаления. Оставшуюся часть использовали для выделения децидуальных клеток.

Иммуногистохимия

Фиксированные формалином и залитые парафином срезы толщиной 5 мкм депарафинизировали в ксилоле и регидратировали в этаноле с градуированной серией.Иммуноокрашивание на MMP2, тканевой ингибитор матриксной металлопротеиназы 1 (TIMP1), тканевой ингибитор матриксной металлопротеиназы 2 (TIMP2), виментин и цитокератин включало кипячение в цитратном буфере (10 мМ; pH 6,0) в течение 20 минут, а затем срезы для окрашивания виментином. инкубировали во влажной камере с трипсином в течение 5 мин для поиска антигена. Срезы для окрашивания цитокератином, MMP2, MMP9, TIMP1 и TIMP2 погружали в 3% перекись водорода (50% метанол/50% дистиллированная вода) на 10 мин для блокирования активности эндогенной пероксидазы.После промывания несколько раз в трис-буферном солевом растворе (TBS; pH 7,6) предметные стекла инкубировали во влажной камере с 5% нормальной лошадиной или козьей сывороткой (Vector Laboratories Inc., Burlingame, CA) в TBS в течение 30 мин при комнатной температуре до блокировать неспецифическое связывание. После удаления избытка сыворотки срезы инкубировали с первичными антителами (моноклональное антитело мыши к MMP2 [разведение 1:140; Calbiochem Inc., Сан-Диего, Калифорния] при комнатной температуре в течение 60 мин; поликлональное антитело кролика MMP9 [разведение 1:100; NeoMarkers , Фремонт, Калифорния] в течение ночи при 4°C; кроличье поликлональное антитело TIMP1 или TIMP2 [разведение 1:400; NeoMarkers] в течение ночи при 4°C; мышиное моноклональное антитело к виментину [разведение 1:100; Abcam, Кембридж, Массачусетс] при комнатной температуре в течение 30 минут и мышиное моноклональное антитело к цитокератину [разведение 1:100; DAKO Inc., Carpinteria, CA] при комнатной температуре в течение 45 мин) во влажной камере. Для отрицательного контроля срезы обрабатывали либо нормальными мышиными моноклональными антителами изотипа иммуноглобулина G1 (IgG1), либо нормальными кроличьими антителами IgG (R&D Systems Inc., Миннеаполис, Миннесота). Срезы промывали в TBS три раза по 5 мин каждый, затем добавляли биотинилированные лошадиные антимышиные или антикроличьи антитела (Vector Laboratories) в разведении 1:400 на 30 мин при комнатной температуре. После трехкратной промывки в ТБС по 5 мин комплекс антиген-антитело выявляли с помощью набора авидин-пероксидаза или набора авидин-щелочная фосфатаза (Vector Laboratories).Иммунореакцию разрабатывали с использованием хромогенов диаминобензидина (дегидрат 3,3-диаминобензидина тетрагидрохлорида; Vector Laboratories) для MMP2, MMP9, TIMP1 и TIMP2 и Fast Red (Vector Laboratories) для виментина и цитокератина. Срезы были контрастно окрашены гематоксилином (Sigma) и помещены в Permount (Fisher Chemicals, Springfield, NJ) на предметные стекла.

Интенсивность иммуноокрашивания MMP2, MMP9, TIMP1 и TIMP2 оценивали полуколичественно по следующим категориям: 0 (отсутствие окрашивания), 1+ (слабое, но обнаруживаемое окрашивание), 2+ (умеренное или отчетливое окрашивание) и 3 + (интенсивное окрашивание).Для каждой ткани значение HSCORE было получено путем взятия суммы процента клеток, окрашенных в каждой категории интенсивности, и умножения этого значения на взвешенную интенсивность окрашивания по формуле HSCORE = Σ P i (i + l ), где i представляет показатель интенсивности, а P i — соответствующий процент окрашивания клеток. На каждом предметном стекле под микроскопом оценивали пять различных областей и 100 клеток на поле с увеличением объектива ×40. Средняя оценка была получена после оценки двумя исследователями, слепыми к образцам.

Изоляция децидуальных клеток

Ткани измельчали ​​и расщепляли с помощью 0,1% коллагеназы типа IV и 0,01% ДНКазы в среде RPMI-1640, содержащей 20 мкг/мл пенициллина/стрептомицина, 1 мкл/мл фунгизона (Gibco, Гранд-Айленд, Нью-Йорк) на водяной бане со встряхиванием при 37°C. в течение 30 мин. После промывки стерильным PBS дигестат трижды промывали и подвергали последовательной фильтрации через миллипоровые фильтры 100, 70 и 40 мкм. Клетки ресуспендировали в RPMI-1640, выращивали до слияния на чашках для культур тканей из полистирола, собирали с использованием трипсина/ЭДТА и анализировали с помощью проточного цитометрического анализа с анти-CD45 и анти-CD14 mAb (BD Pharmingen, Сан-Диего, Калифорния) для мониторинга наличие лейкоцитов после каждого пассажа.После трех-четырех пассажей было обнаружено, что клеточные культуры не содержат лейкоцитов (<1%). Монослои этих децидуальных клеток были виментин-позитивными и цитокератин-отрицательными и демонстрировали связанные с децидуализацией морфологические и биохимические изменения во время инкубации с прогестином. Последние включали повышенную экспрессию пролактина и ингибитора активатора плазминогена 1 (PAI1) и ингибированную экспрессию MMP1 и MMP3 (данные не показаны). Аликвоты клеток замораживали в смеси эмбриональной телячьей сыворотки/диметилсульфоксида (9:1; Sigma-Aldrich) и хранили в жидком азоте.

Экспериментальные инкубации децидуальных клеток

Размороженные клетки инкубировали в базовой среде, не содержащей фенолового красного, смеси Dulbecco MEM (Gibco) и Ham F-12 (Flow Labs, Rockville, MD) 1:1 по объему со 100 ед./мл пенициллина, 100 мкг. /мл стрептомицина, 0,25 мкг/мл фунгизона с добавлением 10% телячьей сыворотки, очищенной углем (BMS). После двух дополнительных пассажей конфлюэнтные культуры параллельно инкубировали в BMS, содержащей либо 10 -8 ME 2 , либо E 2 + 10 -7 М медроксипрогестерона ацетата (МПА; Sigma-Aldrich), который использовали в место прогестерона из-за его большей стабильности в культуральных условиях [35].Через 7 дней культуры дважды промывали сбалансированным солевым раствором Хэнкса для удаления остаточной сыворотки. Затем культуры были переведены на определенную среду (DM), состоящую из основной среды плюс ITS + (Collaborative Research, Waltham, MA), 5 мкМ FeSO 4 , 50 мкМ ZnSO 4 , 1 нМ CuS O . , 20 нМ Na 2 SeO 3 , микроэлементы (Gibco), 50 мкг/мл аскорбиновой кислоты (Sigma-Aldrich) и 50 нг/мл эпидермального фактора роста (Becton-Dickinson, Bedford, MA), либо управление транспортным средством (0.1% этанола) или стероиды с добавлением или без добавления 0,01–10 нг/мл IL1B или TNF (R&D Systems). После периода тестирования клетки собирали соскобом в охлажденный льдом PBS, осаждали и экстрагировали в охлажденном льдом лизирующем буфере. Кондиционированные супернатанты среды и клеточные лизаты хранили при -70°С. В параллельных инкубациях тотальную РНК экстрагировали Tri Reagent (Sigma-Aldrich).

Биохимические анализы

Уровни общего клеточного белка измеряли с помощью модифицированного анализа Лоури (Bio-Rad Laboratories, Hercules, CA).Коммерческие наборы ELISA использовали для измерения общих уровней иммунореактивности без образования комплексов каждой из MMP2, MMP9, TIMP1 и TIMP2 в кондиционированной среде в соответствии с инструкциями, предоставленными производителем (наборы Quantikine; R&D Systems). Оба теста ELISA для MMP имеют чувствительность 0,16 нг/мл. Коэффициенты вариации анализа MMP2 для внутрианализа и между анализами составляют 4,8% и 7,7% соответственно. Коэффициенты вариации анализа MMP9 для внутрианализа и между анализами составляют 2,3% и 7,5% соответственно.Оба теста TIMP ELISA имеют чувствительность менее 0,011 нг/мл. Коэффициенты вариации TIMP1 для внутрианализа и между анализами составляют 4,8% и 7,7% соответственно. Коэффициенты вариации TIMP2 для внутрианализа и между анализами составляют 5,6% и 6,9% соответственно.

Гель-субстрат для зимографии

Гель-зимографию с желатином в качестве субстрата в геле использовали для определения протеолитической активности MMP2 и MMP9. Кондиционированные среды из культур децидуальных клеток центрифугировали, супернатанты предварительно обрабатывали диметилсульфоксидом в концентрации менее 7% от общего объема с добавлением и без добавления 2 мМ аминофенилмеркурацетата (APMA; Sigma) при 37°C в течение 2 ч.Этот APMA преобразует латентные (про) формы MMP в их активные формы. Эту реакцию останавливали, смешивая образцы 1:1 с невосстанавливающим буфером для образцов Zymogram (Bio-Rad Laboratories) и затем инкубируя в течение 10 минут при комнатной температуре. Образцы наносили на 10% желатиновый гель Zymogram (Bio-Rad Laboratories), затем подвергали электрофорезу в течение 1,75 ч в трис-глициновом SDS-буфере. Чтобы дать возможность ферментам ренатурировать, гель инкубировали в течение 45 минут в 2,5% Triton X-100 (BioRad Laboratories) при комнатной температуре и инкубировали в проявочном буфере Zymogram (Bio-Rad Laboratories) в течение 30 минут, а затем помещали в свежий Zymogram. буфер для проявления в течение ночи при 37°C.Гель окрашивали 0,5% раствором кумасси бриллиантового синего (Sigma) в смеси метанол/уксусная кислота/вода (40:10:50 по объему) в течение 2 ч при комнатной температуре, а затем обесцвечивали смесью метанол/уксусная кислота/вода (30 :10:60 об./об.) в течение 4 ч при комнатной температуре. Наличие четких полос в гелях при соответствующей молекулярной массе отражает желатонолитическую активность латентной (про) и активной форм ММП2 и ММП9.

Вестерн-блоттинг

Вестерн-блот анализ проводили на концентрированных кондиционированных супернатантах DM, которые разводили 1:6 в 6-кратном буфере для образцов Laemmli (Boston Bioproducts, Boston, MA) и затем кипятили в течение 4 минут.Отцентрифугированные среды подвергали SDS-PAGE на геле 7,5% Tris-HCl (Bio-Rad Laboratories) с последующим электроблотинговым переносом на нитроцеллюлозную мембрану 0,2 мкм (Bio-Rad Laboratories). После переноса мембрану блокировали в течение ночи в Трис-буферном солевом растворе (Fisher, Fairlawn, NJ) с 4% обезжиренным сухим молоком, а затем инкубировали в течение 2 часов с 0,1 мкг/мл мышиного моноклонального антитела против MMP9 человека (R&D Systems). . Мембраны промывали в PBS и 0,1% Tween 20 до и после инкубации с антимышиным IgG, конъюгированным с пероксидазой хрена (ICN Biomedicals, Aurora, OH).Хемилюминесценцию определяли с помощью реагентов ECL (Perkin-Elmer Life Sciences, Boston, MA) и пленки для авторадиографии (Amersham Pharmacia) в соответствии с инструкциями производителя. Затем эту же мембрану промывали, как указано выше, и инкубировали в буфере для стриптиза (100 мМ 2-меркаптоэтанол, 2% SDS, 62,5 мМ Трис-HCl, pH 6,7) в течение 30 мин при 50°C с последующей промывкой и повторным блокированием, как указано выше. Затем мембрану инкубировали в течение 2 ч с 1 мкг/мл мышиного моноклонального антитела против MMP2 человека (Oncogene, Сан-Диего, Калифорния) и обрабатывали, как указано выше.

Количественная ОТ-ПЦР в реальном времени

Для проверки того, что зонды MMP2, MMP9 и бета-актина (ACTB) давали правильные полосы, РНК, выделенную из экспериментальных инкубаций клеток, подвергали полуколичественной ОТ-ПЦР с использованием набора от Invitrogen (Карлсбад, Калифорния) и проведения 35 циклов. с Eppendorf Mastercycler (Eppendorf, Westbury, NY). Для проведения количественной ОТ-ПЦР в реальном времени сначала проводили обратную транскрипцию с помощью обратной транскриптазы AMV (Invitrogen).Количественную стандартную кривую строили между 1 и 40 нг кДНК с помощью Roche Light Cycler (Roche, Indianapolis, IN) путем наблюдения за повышением флуоресценции продуктов ПЦР во время амплификации. После установления стандартной кривой количественное определение неизвестных веществ было определено с помощью Roche Light Cycler и приведено к количественному выражению ACTB по соответствующим неизвестным веществам. Анализ кривой плавления определил специфичность амплифицированных продуктов и отсутствие образования праймер-димера.Все полученные продукты имели правильную температуру плавления. Праймеры, перечисленные в таблице 1, были синтезированы и очищены на геле в Yale DNA Synthesis Laboratory, Critical Technologies.

Таблица 1

Праймеры, используемые для количественной ОТ-ПЦР в реальном времени.

Зонд . Смысл (от 5 до 3 футов) . Антисмысловые (от 5′ до 3′) . Размер .
ACTB CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG 452 п.н.
ММР2 CCACTGCCTTCGATACAC GAGCCACTCTCTGGAATCTTAAA 133 п.н.
ММР9 GTTCCCGGAGTGAGTTGA TTTACATGGCACTGCAAAGC 109 п.н.
Зонд . Смысл (от 5 до 3 футов) . Антисмысловые (от 5′ до 3′) . Размер .
ACTB CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG 452 п.н.
ММР2 CCACTGCCTTCGATACAC GAGCCACTCTCTGGAATCTTAAA 133 п.н.
ММР9 GTTCCCGGAGTGAGTTGA TTTACATGGCACTGCAAAGC 109 п.н.
Таблица 1

Праймеры, используемые для количественной ОТ-ПЦР в реальном времени.

Зонд . Смысл (от 5 до 3 футов) . Антисмысловые (от 5′ до 3′) . Размер .
ACTB CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG 452 п.н.
ММР2 CCACTGCCTTCGATACAC GAGCCACTCTCTGGAATCTTAAA 133 п.н.
ММР9 GTTCCCGGAGTGAGTTGA TTTACATGGCACTGCAAAGC 109 п.н.
Зонд . Смысл (от 5 до 3 футов) . Антисмысловые (от 5′ до 3′) . Размер .
ACTB CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG 452 п.н.
ММР2 CCACTGCCTTCGATACAC GAGCCACTCTCTGGAATCTTAAA 133 п.н.
ММР9 GTTCCCGGAGTGAGTTGA TTTACATGGCACTGCAAAGC 109 п.н.

Статистический анализ

Сравнения контрольной группы и различных экспериментальных групп были выполнены с использованием рангового критерия Крускала-Уоллиса ANOVA с последующим апостериорным критерием Стьюдента-Ньюмана-Кеулса со значением P <0.05, представляющий статистическую значимость. Для иммуногистохимического анализа HSCORES использовались тесты t для сравнения контрольных образцов с образцами преэклампсии, при этом P <0,05 представляло статистическую значимость.

Результаты

Иммуноокрашивание MMP9 и MMP2 в децидуе

Децидуальные клетки в срезах базальной децидуальной оболочки недоношенных контролей (рис. 1B и 2B) и образцов преэклампсии (рис.1D и 2D) отличались иммунореактивностью виментина. Клетки интерстициального цитотрофобласта в срезах базальной децидуальной оболочки недоношенных контролей (рис. 1Б и 2Б, вставки) отличались цитокератиновой иммунореактивностью.

Рис. 1

Иммуногистохимическая экспрессия MMP9 в децидуальных клетках недоношенных образцов. Иммунореактивность MMP9 (коричневый цвет) очевидна в децидуальных тканях недоношенных ( A ) и преэклампсии ( C ). Децидуальные клетки окрашены на виментин (красный) в децидуальной оболочке женщин с преждевременными родами ( B ) и преэклампсией ( D ).Вставка в B демонстрирует клетки интерстициального трофобласта, окрашенные на цитокератин (красный). E ) Отрицательный контроль. Оригинальное увеличение ×40. Значения HSCORE для экспрессии MMP9 ( F ) сравнивают между децидуальными клетками контрольной группы недоношенных (n = 11) и клетками преэклампсии (n = 11; * P <0,001), а также между клетками интерстициального трофобласта контрольной группы недоношенных. и образцы преэклампсии (незначительные).

Рис. 1

Иммуногистохимическая экспрессия MMP9 в децидуальных клетках недоношенных образцов.Иммунореактивность MMP9 (коричневый цвет) очевидна в децидуальных тканях недоношенных ( A ) и преэклампсии ( C ). Децидуальные клетки окрашены на виментин (красный) в децидуальной оболочке женщин с преждевременными родами ( B ) и преэклампсией ( D ). Вставка в B демонстрирует клетки интерстициального трофобласта, окрашенные на цитокератин (красный). E ) Отрицательный контроль. Оригинальное увеличение ×40. Значения HSCORE для экспрессии MMP9 ( F ) сравнивают между децидуальными клетками контрольной группы недоношенных (n = 11) и клетками преэклампсии (n = 11; * P <0.001), а также между клетками интерстициального трофобласта из контрольной группы недоношенных и преэклампсии (незначительно).

Рис. 2

Иммуногистохимическая экспрессия MMP2 в децидуальных клетках недоношенных образцов. Иммунореактивность матриксной металлопротеиназы 2 (коричневый цвет) проявляется в контрольной ( A ; n = 11) и преэклампсии ( C ; n = 11) децидуальной ткани. Децидуальные клетки окрашены на виментин (красный) в децидуальной оболочке женщин с преждевременными родами ( B ) и преэклампсией ( D ). E ) Отрицательный контроль. Оригинальное увеличение ×40. Вставка в B демонстрирует клетки интерстициального трофобласта, окрашенные на цитокератин (красный). Значения HSCORE для экспрессии MMP2 ( F ) сравнивают между децидуальными клетками недоношенных контролей и таковыми из преэклампсии, а также между клетками интерстициального трофобласта контролей и преэклампсией (оба значения не имеют значения).

Рис. 2

Иммуногистохимическая экспрессия MMP2 в децидуальных клетках недоношенных образцов.Иммунореактивность матриксной металлопротеиназы 2 (коричневый цвет) проявляется в контрольной ( A ; n = 11) и преэклампсии ( C ; n = 11) децидуальной ткани. Децидуальные клетки окрашены на виментин (красный) в децидуальной оболочке женщин с преждевременными родами ( B ) и преэклампсией ( D ). E ) Отрицательный контроль. Оригинальное увеличение ×40. Вставка в B демонстрирует клетки интерстициального трофобласта, окрашенные на цитокератин (красный). Значения HSCORE для экспрессии MMP2 ( F ) сравнивают между децидуальными клетками недоношенных контролей и таковыми из преэклампсии, а также между клетками интерстициального трофобласта контролей и преэклампсией (оба значения не имеют значения).

Иммунореактивность матриксной металлопротеиназы 9 (коричневое пятно) показана в децидуальных клетках как контрольных образцов недоношенных (рис. 1А), так и образцов преэклампсии (рис. 1С). Значения HSCORE уровней MMP9 (рис. 1F) в децидуальных клетках образцов с преэклампсией (среднее значение ± стандартная ошибка среднего: 183 ± 5) были значительно выше, чем у недоношенных контролей (125 ± 9; P <0,001). Иммуноокрашивание на MMP9 в интерстициальных цитотрофобластах существенно не отличалось между преэклампсией (127 ± 7) и недоношенными контрольными образцами (115 ± 10).Отрицательный контроль антител показан на рисунке 1E.

Аналогичным образом, иммунореактивность MMP2 (коричневое пятно) проявляется в децидуальных клетках как в контрольной группе недоношенных (рис. 2А), так и в преэклампсии (рис. 2С). Не было никаких существенных изменений в значениях HSCORE для иммунореактивности MMP2 (рис. 2F) в децидуальных клетках из образцов преэклампсии (среднее значение ± стандартная ошибка среднего: 162 ± 6) по сравнению с таковыми в контрольной группе недоношенных (139 ± 11). Точно так же не было существенной разницы между значениями HSCORE иммунореактивности MMP2 в клетках интерстициального цитотрофобласта из контрольной группы недоношенных (105 ± 8) и преэклампсии (111 ± 9).Отрицательный контроль антител показан на рисунке 2E.

Иммуноокрашивание TIMP1 и TIMP2 в децидуальной оболочке

Тканевой ингибитор MMP1 показал слабую иммунореактивность как в контрольных образцах недоношенных (рис. 3А), так и в преэклампсии (рис. 3С). Значения HSCORE окрашивания TIMP1 (рис. 3G) существенно не отличались между недоношенными контрольными и преэкламптическими образцами ни в децидуальных клетках (среднее значение ± стандартная ошибка среднего: 32 ± 10 по сравнению с 36 ± 4 соответственно), ни в интерстициальных цитотрофобластах (30 ± 9 по сравнению с22 ± 4 соответственно). Тканевой ингибитор иммунореактивности MMP2 также был слабым у недоношенных контрольных (рис. 3B) и преэклампсии (рис. 3D) образцов. Тканевой ингибитор MMP2 Значения HSCORE (рис. 3H) существенно не различались между недоношенными контрольными и преэкламптическими образцами ни в децидуальных клетках (80 ± 24 против 102 ± 13 соответственно), ни в интерстициальных трофобластах (64 ± 15 против 63 ± 12, соответственно). соответственно). Отрицательный контроль антител для TIMP1 и TIMP2 не выявил окрашивания, как показано на фиг. 3, E и F соответственно.

Рис. 3

Иммуногистохимическая экспрессия TIMP1 и TIMP2 в децидуальных клетках недоношенных образцов. Иммунореактивность TIMP1 и TIMP2 (коричневый цвет) проявляется в недоношенных контрольных ( A и B соответственно; n = 5) и преэклампсии ( C и D соответственно; n = 6) децидуальных тканях. Показаны отрицательные контроли для TIMP1 и TIMP2 ( E и F соответственно). Оригинальное увеличение ×40. Значения HSCORE для экспрессии TIMP1 ( G ) и TIMP2 ( H ) сравнивают между децидуальными клетками недоношенных контролей и преэклампсией, а также между клетками интерстициального трофобласта контролей и преэклампсией (оба значения не имеют значения).Для недоношенных контролей n = 5; для случаев преэклампсии n = 6. Гестационный возраст составлял 28,5 ± 1,3 недели и 29,9 ± 1,0 недели (среднее значение ± стандартная ошибка среднего) для недоношенных контролей и случаев преэклампсии, соответственно. Гестационный возраст статистически не отличался.

Рис. 3

Иммуногистохимическая экспрессия TIMP1 и TIMP2 в децидуальных клетках недоношенных образцов. Иммунореактивность TIMP1 и TIMP2 (коричневый цвет) проявляется в недоношенных контрольных ( A и B соответственно; n = 5) и преэклампсии ( C и D соответственно; n = 6) децидуальных тканях.Показаны отрицательные контроли для TIMP1 и TIMP2 ( E и F соответственно). Оригинальное увеличение ×40. Значения HSCORE для экспрессии TIMP1 ( G ) и TIMP2 ( H ) сравнивают между децидуальными клетками недоношенных контролей и преэклампсией, а также между клетками интерстициального трофобласта контролей и преэклампсией (оба значения не имеют значения). Для недоношенных контролей n = 5; для случаев преэклампсии n = 6. Срок беременности составил 28 лет.5 ± 1,3 недели и 29,9 ± 1,0 недели (среднее значение ± стандартная ошибка среднего) для недоношенных контролей и случаев преэклампсии соответственно. Гестационный возраст статистически не отличался.

Экспрессия белков MMP9 и MMP2 в культурах монослоя децидуальных клеток

На рис. 4 описаны раздельные и интерактивные эффекты MPA и цитокинов на продукцию MMP2 (рис. 4A) и MMP9 (рис. 4B) децидуальными клетками, не содержащими лейкоцитов, в первом триместре. Циркулирующие уровни E 2 и прогестерона повышены в течение первого триместра, что требует использования E 2 в качестве контрольной инкубации для E 2 + MPA.Базальный выброс MMP2 был в несколько раз выше, чем у MMP9, и на него не влияло воздействие ни MPA, ни воспалительных цитокинов (рис. 4А). Хотя MPA также не влиял на базальный выход MMP9, он заметно увеличивался во время инкубации с провоспалительными цитокинами (рис. 4B). По сравнению с базовым выходом в культурах, инкубированных только с E 2 (0,29 ± 0,02 пг/мл на микрограмм клеточного белка, n = 8), выход MMP9 был повышен до 42,5 ± 19,7 и 264,7 ± 151,5 ( P < 0). .05) на 1 нг/мл IL1B и TNF соответственно. Аналогичным образом, в культурах, инкубированных параллельно с E 2 + MPA, IL1B и TNF повышали выход MMP9 до 51,0 ± 27,1 и 495,1 ± 269,6 соответственно по сравнению с 0,44 ± 0,16 пг/мл на микрограмм клеточного белка в культурах, поддерживаемых в E 2 + только МФК ( P < 0,05). Более того, E 2 + MPA не влиял на выход MMP9 по сравнению с E 2 отдельно и не влиял на реакцию на IL1B и TNF. На рис. 4C показаны результаты рис. 4, A и B в виде кратных изменений от E 2 для каждого эксперимента, чтобы сравнить конститутивный выход MMP2 с заметным усилением выхода MMP9, вызванным IL1B (214 ± 128 раз) и TNF ( 1977 ± 1125 раз), P < 0.05.

Рис. 4

Влияние E 2 , MPA, IL1B и TNF на выработку MMP2 и MMP9 монослоями децидуальных клеток в первом триместре беременности. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с или без 1 нг/мл IL1B или TNF в течение 24 часов. Уровни матриксной металлопротеиназы 2 и MMP9, измеренные с помощью ELISA в кондиционированном DM и нормализованные по клеточному белку (n = 8; среднее ± SEM). А ) ММП2; линейный график: ордината нг/мл на микрограмм белка. В ) ММП9; линейный график: ордината пг/мл на микрограмм белка. С ) ММП2 и ММП9; полулогарифмический график: изменение кратности ординаты от E 2 . *По сравнению с E 2 или E 2 + MPA; ** по сравнению с соответствующим изменением кратности MMP2; Р < 0,05.

Рис. 4

Влияние E 2 , MPA, IL1B и TNF на выработку MMP2 и MMP9 монослоями децидуальных клеток первого триместра.Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с или без 1 нг/мл IL1B или TNF в течение 24 часов. Уровни матриксной металлопротеиназы 2 и MMP9, измеренные с помощью ELISA в кондиционированном DM и нормализованные по клеточному белку (n = 8; среднее ± SEM). А ) ММП2; линейный график: ордината нг/мл на микрограмм белка. В ) ММП9; линейный график: ордината пг/мл на микрограмм белка. С ) ММП2 и ММП9; полулогарифмический график: изменение кратности ординаты от E 2 . *По сравнению с E 2 или E 2 + MPA; ** по сравнению с соответствующим изменением кратности MMP2; Р < 0,05.

Зимограммы, представленные на рис. 5, демонстрируют, что среда, кондиционированная децидуальными клетками, содержит дискретные зоны желатинолитической активности, которые соответствуют ММР2 и ММР9 с молекулярной массой 72 кДа и 92 кДа соответственно; то есть проформы MMP. [36]. Как свидетельствуют зимограммы, предварительная обработка среды, кондиционированной децидуальными клетками, ртутьорганическим АФМА сдвигает практически все формы про-ММП в активные формы ММП (66 кДа для ММП2 и 86 кДа для ММП9).В соответствии с дифференциальной регуляцией MMP2 и MMP9, на которую указывают результаты ELISA на фигуре 4, ни цитокины, ни MPA не влияли на величину MMP2, тогда как величина MMP9 была заметно увеличена под действием IL1B и TNF, но не изменилась под действием MPA. Вестерн-блоттинг, представленный на фиг. 6, подтверждает результаты ELISA и зимографии, демонстрируя, что децидуальные клетки секретируют ММР2 и ММР9 в их проформах, которые соответствуют молекулярным массам проформ положительных контролей.

Рис.5

Влияние E 2 , MPA, IL1B и TNF на активность желатиназы MMP2 и MMP9 в монослоях децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 (верхняя панель) или Е 2 + 10 -7 МПА (нижняя панель), затем переводили на ДМ с соответствующий стероид(ы) с или без 1 нг/мл IL1B или TNF в течение 24 часов. Аликвоты кондиционированного DM подвергали желатиновой зимографии после предварительной обработки ртутьорганическим APMA и без него, который превращает проформы (Pro) MMP в их активные формы (Act).продолжение, контроль; отрицательный, отрицательный контроль.

Рис. 5

Влияние E 2 , MPA, IL1B и TNF на активность желатиназы MMP2 и MMP9 в монослоях децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 (верхняя панель) или Е 2 + 10 -7 МПА (нижняя панель), затем переводили на ДМ с соответствующий стероид(ы) с или без 1 нг/мл IL1B или TNF в течение 24 часов. Аликвоты кондиционированного DM подвергали желатиновой зимографии после предварительной обработки ртутьорганическим APMA и без него, который превращает проформы (Pro) MMP в их активные формы (Act).продолжение, контроль; отрицательный, отрицательный контроль.

Рис. 6

Вестерн-блоттинг эффектов E 2 , MPA, IL1B и TNF на уровни секретируемых MMP2 и MMP9 монослоями децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с 1 или без 1 нг/мл IL1B или TNF в течение 24 часов. Аликвоты кондиционированной DM подвергали восстанавливающему SDS-PAGE, переносили на нитроцеллюлозу и иммуноокрашивали на MMP9, затем удаляли и повторно исследовали на MMP2.Положительный контроль представлял собой рекомбинантные белки человека, которые являются только проформами MMP2 и MMP9.

Рис. 6

Вестерн-блоттинг эффектов E 2 , MPA, IL1B и TNF на уровни секретируемых MMP2 и MMP9 монослоями децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с 1 или без 1 нг/мл IL1B или TNF в течение 24 часов.Аликвоты кондиционированной DM подвергали восстанавливающему SDS-PAGE, переносили на нитроцеллюлозу и иммуноокрашивали на MMP9, затем удаляли и повторно исследовали на MMP2. Положительный контроль представлял собой рекомбинантные белки человека, которые являются только проформами MMP2 и MMP9.

Поскольку добавление прогестина не модулирует ни базальный, ни усиленный цитокинами выброс MMP9, дозозависимые эффекты IL1B и TNF на выход MMP9 децидуальными клетками, которые были выполнены после праймирования E 2 + MPA, показаны на рис. Рисунок 7.Эти результаты показывают, что уровни секретируемой MMP9 повышались под действием IL1B (фиг. 7A) и TNF (фиг. 7B) в зависимости от концентрации.

Рис. 7

Эффекты TNF и IL1B, зависящие от концентрации, на продукцию MMP9 в монослоях децидуальных клеток в первом триместре беременности, обработанных MPA E 2 + MPA. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 ME 2 + 10 -7 M МПА, затем переводили на DM с одними стероидами и с IL1B ( A ) или TNF (). B ) в течение 24 часов.По оси абсцисс указаны концентрации цитокинов в единицах нг/мл. Уровни матриксной металлопротеиназы 9 измеряли с помощью ELISA в кондиционированных DM и нормализовали по клеточному белку (n = 4; среднее ± SEM). *По сравнению с E 2 + МПА; **по сравнению с 0,1 нг/мл ФНО; Р < 0,05.

Рис. 7

Эффекты TNF и IL1B, зависящие от концентрации, на продукцию MMP9 в монослоях децидуальных клеток первого триместра, обработанных MPA, E 2 + MPA. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 ME 2 + 10 -7 M МПА, затем переводили на DM с одними стероидами и с IL1B ( A ) или TNF (). B ) в течение 24 часов.По оси абсцисс указаны концентрации цитокинов в единицах нг/мл. Уровни матриксной металлопротеиназы 9 измеряли с помощью ELISA в кондиционированных DM и нормализовали по клеточному белку (n = 4; среднее ± SEM). *По сравнению с E 2 + МПА; **по сравнению с 0,1 нг/мл ФНО; Р < 0,05.

MMP9 и MMP2 Экспрессия мРНК в культурах монослоя децидуальных клеток

На рис. 8 показаны стационарные MMP2 (рис. 8A) и MMP9 (рис.8B) уровни мРНК, определенные с помощью количественной ОТ-ПЦР в реальном времени в параллельных культурах, праймированных либо E 2 , либо E 2 + MPA. В соответствии с результатами для уровней секретируемой MMP2 и MMP9, показанными на рисунке 4, ни MPA, ни IL1B, ни TNF не оказывали значительного влияния на уровни мРНК MMP2 , тогда как уровни мРНК MMP9 заметно увеличивались с помощью IL1B и TNF. Как показано на Фигуре 8C, кратность изменений по сравнению с обработкой только E 2 указывает на отсутствие статистически значимого влияния MPA на уровни мРНК MMP9 , тогда как IL1B и TNF повышали уровни мРНК MMP9 на 54.3 ± 13,7 раза и 103,9 ± 40,0 раза соответственно.

Рис. 8

Влияние E 2 , MPA, IL1B и TNF на уровни мРНК MMP2 и MMP9 в монослоях децидуальных клеток первого триместра. Конфлюэнтные пассированные децидуальные клетки без лейкоцитов инкубировали в течение 7 дней в 10 -8 ME 2 + 10 -7 M МПА, затем переводили на ДМ с E 2 + 10 -7 M MPA или с IL1B или TNF в течение 6 часов.Количественную ОТ-ПЦР в реальном времени проводили на выделенной РНК для MMP2 и MMP9 , нормализованных к ACTB мРНК (n = 4; среднее значение ± стандартная ошибка среднего). P < 0,05 *по сравнению с E 2 или E 2 + МФК; **по сравнению с соответствующим кратным изменением MMP2 . А ) ММП2 ; линейный график: ордината РНК/ ACTB мРНК. В ) ММП9 ; линейный график: ордината РНК/ ACTB мРНК. C ) MMP2 и MMP9 ; полулогарифмический график: изменение кратности ординаты от E 2 .

Рис. 8

Влияние E 2 , MPA, IL1B и TNF на уровни мРНК MMP2 и MMP9 в монослоях децидуальных клеток первого триместра. Конфлюэнтные пассированные децидуальные клетки без лейкоцитов инкубировали в течение 7 дней в 10 -8 ME 2 + 10 -7 M МПА, затем переводили на ДМ с E 2 + 10 -7 M MPA или с IL1B или TNF в течение 6 часов. Количественную ОТ-ПЦР в реальном времени проводили на выделенной РНК для MMP2 и MMP9 , нормализованных к ACTB мРНК (n = 4; среднее значение ± стандартная ошибка среднего). P < 0,05 *по сравнению с E 2 или E 2 + МФК; **по сравнению с соответствующим кратным изменением MMP2 . А ) ММП2 ; линейный график: ордината РНК/ ACTB мРНК. В ) ММП9 ; линейный график: ордината РНК/ ACTB мРНК. C ) MMP2 и MMP9 ; полулогарифмический график: изменение кратности ординаты от E 2 .

Экспрессия белков TIMP1 и TIMP2 в культурах монослоя децидуальных клеток

На рис. 9 представлены результаты ELISA добавления IL1B и TNF к секретируемым уровням TIMP1 и TIMP2 культурами децидуальных клеток человека в первом триместре.Обратите внимание, что в отличие от заметного увеличения ответов MMP9, не было значительного влияния любого цитокина на уровни TIMP1 или TIMP2.

Рис. 9

Влияние E 2 , MPA, IL1B и TNF на продукцию TIMP1 (верхняя панель) и TIMP2 (нижняя панель) монослоями децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с или без 1 нг/мл IL1B или TNF в течение 24 часов.Секретируемые уровни TIMP1 и TIMP2 измеряли с помощью ELISA в кондиционированном DM и нормализовали по клеточному белку (n = 8; среднее значение ± стандартная ошибка среднего). Не было обнаружено никакой значимости при сравнении исходного уровня с любым цитокином для TIMP1 или TIMP2.

Рис. 9

Влияние E 2 , MPA, IL1B и TNF на продукцию TIMP1 (верхняя панель) и TIMP2 (нижняя панель) монослоями децидуальных клеток первого триместра. Сливающиеся, свободные от лейкоцитов децидуальные клетки инкубировали в течение 7 дней в 10 -8 МЕ 2 или Е 2 + 10 -7 МПА, затем переводили на ДМ с соответствующими стероидами с или без 1 нг/мл IL1B или TNF в течение 24 часов.Секретируемые уровни TIMP1 и TIMP2 измеряли с помощью ELISA в кондиционированном DM и нормализовали по клеточному белку (n = 8; среднее значение ± стандартная ошибка среднего). Не было обнаружено никакой значимости при сравнении исходного уровня с любым цитокином для TIMP1 или TIMP2.

Обсуждение

Ключевая роль, которую играет глубина инвазии EVT в децидуальную оболочку человека в ремоделировании спиральных артерий и артериол в сосуды с низким сопротивлением и высокой емкостью, вместе с влиянием, которое эта трансформация оказывает на маточно-плацентарный кровоток, спровоцировали многочисленные исследования инвазивности нормальных и иммортализованных EVT первого триместра.Такие исследования показывают, что миграция и инвазия EVT могут модулироваться несколькими факторами, экспрессируемыми трофобластами и децидуальными клетками на границе между матерью и плодом. К ним относятся инсулиноподобный фактор роста 2 (IGF2), его маннозо-6-фосфатный рецептор IGF2 [37] и IGF-связывающий белок 1 (IGFBP1) [38, 39], простагландин E 2 и его рецептор EP1 (PTGER1) [38, 39]. 40], а также изоформы трансформирующего фактора роста бета (TGFB) и декорин, который хранит TGFB в децидуальном ВКМ [41–43].

Миграция и инвазия EVT человека имеют сходство с хорошо изученными процессами в опухолевых клетках.Инвазия опухолевых клеток также включает последовательную интегрин-опосредованную адгезию, а затем протеолиз компонентов ВКМ ткани хозяина [18, 44]. Многочисленные наблюдения в исследованиях опухолевых клеток подчеркивают важную роль, которую играют урокиназа [45] и ММР, особенно ММР2 и ММР9 [17, 46], а также соответствующие модулирующие действия ингибитора активатора плазминогена 1 (PAI1) [45] и ТИМП [46]. ]. Использование иммуногистохимии и гибридизации in situ в тканях человека в сочетании с исследованиями на моделях трансгенных раковых мышей показывают, что во время роста опухоли, инвазии и метастазирования стромальные клетки хозяина вносят основной вклад в образование урокиназы и ММП, при этом раковые клетки высвобождаются в первую очередь. стимулировать соседние стромальные клетки к синтезу ключевых компонентов, регулирующих оборот ВКМ [47, 48].

По сравнению с инвазией опухолевых клеток в ткани хозяина инвазия EVT находится под гораздо более строгим пространственным и временным контролем, поскольку она ограничена эндометрием и проксимальным отделом миометрия и прекращается к середине гестации [18, 44, 49]. Решающая роль, которую играет децидуальная оболочка в сдерживании внутренней инвазивности EVT, очевидна из неконтролируемой инвазии, часто с опасными для жизни последствиями, связанными с имплантацией в местах, где децидуальная оболочка отсутствует, как при внематочной беременности, включая беременность с рубцом от кесарева сечения, или ее недостаточность, как в приращении плаценты [50].Несмотря на то, что основную ответственность за инвазию опухолевых клеток несут протеазы, экспрессируемые стромальными клетками хозяина, исследования инвазии EVT в децидуальную оболочку в первую очередь сосредоточены на экспрессии MMP2 и MMP9 трофобластами [18, 23, 49, 51]. В связи с этим недавно было обнаружено, что трофобласты от преэклампсии беременных экспрессируют более низкие уровни MMP2 и MMP9, чем их нормальные аналоги [52]. Напротив, существует недостаток исследований, оценивающих потенциальный вклад протеаз стромального/децидуального происхождения в эту инвазию.

В текущем исследовании оценивали иммунное окрашивание на MMP9 и MMP2 в преэклампсии и контрольных децидуальных срезах. Статистически значимое увеличение окрашивания на MMP9 наблюдалось в децидуальных клетках преэклампсии по сравнению с контрольными образцами, без существенных различий в иммуноокрашивании децидуальных клеток MMP2. Напротив, иммунное окрашивание на ММР не отличалось в соседних интерстициальных трофобластах преэклампсии по сравнению с контрольной плацентой. В соответствии с нашими наблюдениями заметного связанного с преэклампсией увеличения иммуноокрашивания MMP9 в децидуальной оболочке, это исследование показало, что IL1B и TNF заметно повышали экспрессию мРНК и белка MMP9 в культивируемых децидуальных клетках первого триместра, не содержащих лейкоцитов, тогда как MPA не влиял ни на базальный, ни на цитокиновый уровни. -усиленная экспрессия MMP9.В отличие от MMP9, экспрессия MMP2, по-видимому, является конститутивной, поскольку на нее не влияли MPA или воспалительные цитокины, добавляемые по отдельности или вместе.

Результаты зимографии показали, что, как и в других клеточных системах, децидуальные клетки первого триместра секретируют ММР2 и ММР9 в качестве зимогенов [19]. Активация секретируемого зимогена ММР2 обычно опосредуется ММП мембранного типа 1 [53, 54]. Тем не менее, на ранних сроках беременности человека несколько исследований показывают, что активатор плазминогена урокиназного типа (uPA), связанный с поверхностными рецепторами трофобласта, вырабатывает плазмин, который активирует расщепляющие ВКМ про-ММР2 и про-ММР9, способствуя инвазии ЭВТ (обзор в Ferretti et al.[44]). Хотя обычно считается, что трофобласты секретируют про-ММР2 и про-ММР9, которые управляют инвазией, текущие результаты позволяют предположить, что: регулировать инвазию EVT; 2) сверхэкспрессия MMP9 децидуальными клетками способствует неглубокой плацентации, препятствуя нормальной поэтапной инвазии EVT в децидуальную оболочку, опосредованной интегрином. Такое нарушение регуляции, вероятно, усиливается экспрессируемым децидуальными клетками стромелизином 1 (MMP3), зарегистрированным активатором про-MMP9 [55].Недавно мы обнаружили, что MMP3 заметно усиливается TNF и IL1B в децидуальных клетках человека в первом триместре со значительно более высокими уровнями иммунореактивных MMP3 в децидуальных клетках преэклампсии по сравнению с контрольными срезами плаценты того же гестационного возраста (W. Murk et al., неопубликованные результаты).

Исследования в нескольких тканях позволяют предположить, что активность секретируемых про-ММП может блокироваться внеклеточными ТИМП [19]. В то время как все TIMP могут в некоторой степени связываться со всеми MMP, TIMP2 обычно конститутивно экспрессируется и специфичен для MMP2 [56], тогда как экспрессия TIMP1 с высокой аффинностью связывается с MMP9 и может регулироваться провоспалительными цитокинами [57–59]. .Текущее исследование монослоев децидуальных клеток первого триместра выявило ожидаемое отсутствие регуляции экспрессии MMP2 и TIMP2. Однако было обнаружено поразительное несоответствие между экспрессией MMP9 и TIMP1 с многократным повышением экспрессии белка MMP9, вызванным IL1B и TNF, соответственно, которое не сопровождалось значительным увеличением уровней секретируемого TIMP1. Иммуноокрашивание не выявило различий между преэклампсией и контрольными децидуальными образцами того же гестационного возраста для уровней TIMP1 или TIMP2, при этом TIMP1 присутствовал на низких уровнях.

Предыдущие исследования образцов человеческого эндометрия, полученных во время менструального цикла, показали, что уровни мРНК некоторых ММР снижаются во время лютеиновой фазы с преобладанием прогестерона и заметно повышаются в менструальной фазе, инициируемой отменой прогестерона. Напротив, мРНК для TIMP1 и TIMP2 практически не изменились за этот период [22, 24]. В культуре стромальных клеток, полученных из предецидуализированного эндометрия человека, инкубация с прогестином ингибировала экспрессию ММР3 [60] (и интерстициальной коллагеназы [ММР1]), но не экспрессию ММР2 или TIMP1 [20].Кроме того, отмена прогестина увеличивала экспрессию MMP3 и MMP1, но не изменяла экспрессию MMP2, TIMP1 или TIMP2 [20, 61]. Инкубация таких стромальных клеток с IL1B и TNF повышала экспрессию MMP1 и MMP9, тогда как на экспрессию MMP2, TIMP1 и TIMP2 цитокины не влияли [62].

В то время как предыдущие отчеты показывают, что IL1B и TNF усиливают инвазивность EVT за счет повышения уровней MMP9 мРНК, иммунореактивного белка и/или активности [63–65], эти повышения на порядки ниже, чем в сотни-тысячи раз усиление экспрессии белка MMP9 децидуальными клетками, вызванное IL1B и TNF соответственно.Действительно, гипотеза о том, что IL1B и TNF будут индуцировать чистое увеличение инвазии трофобласта в децидуальную оболочку в первом триместре, оспаривается: 1) документально подтвержденной связью между этими цитокинами и преэклампсией [25–27]; 2) установленная взаимосвязь между гестозом и нарушением инвазии ЭВТ в децидуальную оболочку [7–12]; 3) сообщается, что TNF ингибирует инвазивность трофобласта [27, 66]; и 4) недавнее наблюдение, что ингибирование инвазивности трофобласта липополисахарид-активированными макрофагами ослаблялось нейтрализующими TNF антителами [67].Таким образом, наши результаты показывают, что усиление MMP9, экспрессируемого децидуальными клетками, с помощью IL1B и TNF может нарушать целостность состава децидуального ECM. Последующее вмешательство в нормальную ступенчатую инвазию, опосредованную интегрином, в децидуальную оболочку с помощью EVT будет способствовать неглубокой плацентации, обнаруживаемой при преэклампсии.

Каталожные номера

1.

Табанелли

S

,

Тан

B

,

Гурпид

E

.

Децидуализация in vitro стромальных клеток эндометрия человека

.

J Стероиды Biochem Mol Biol

1992

;

42

:

337

344

.2.

Винн

ринггитов

.

Ультраструктурное развитие децидуальной оболочки человека

.

Am J Obstet Gynecol

1974

;

118

:

652

670

.3.

Аплин

JD

,

Чарльтон

АК

,

Айад

S

.

Иммуногистохимическое исследование внеклеточного матрикса эндометрия человека в течение менструального цикла и I триместра беременности

.

Резистентность клеточной ткани

1988

;

253

:

231

240

.4.

Loke

YW

,

Gardner

L

,

Burland

K

,

King

A

.

Ламинин во взаимодействии трофобласта и децидуальной оболочки человека

.

Hum Reprod

1989

;

4

:

457

463

.5.

Фаррар

JD

,

Карсон

DD

.

Дифференциальная временная и пространственная экспрессия мРНК, кодирующей компоненты внеклеточного матрикса в децидуальной оболочке во время периимплантационного периода

.

Биол Репрод

1992

;

46

:

1095

1108

.6.

Мур

КЛ

.

Развивающийся человек, 4-е изд.

.

Филадельфия, Пенсильвания

:

W.B. Компания Сондерс

;

1988

.7.

Дамский

CH

,

Фишер

SJ

.

Псевдоваскулогенез трофобласта: его имитация эндотелиальными рецепторами адгезии

.

Curr Opin Cell Biol

1998

;

10

:

660

666

.8.

Пейненборг

R

,

Vercruysse

L

,

Hanssens

M

.

Спиральные артерии матки при беременности человека: факты и противоречия

.

Плацента

2006

;

27

:

939

958

.9.

DAMSKY

CH

,

70008,

C

,

,

KH

,

TITZGERALD

мл

,

MCMaster

MT

,

Janatpour

M

,

Zhou

y

,

Логан

СК

,

Фишер

SJ

.

Переключение интегрина регулирует нормальную инвазию трофобласта

.

Развитие

1994

;

120

:

3657

3666

.10.

Bulla

R

,

Villa

A

,

,

,

F

,

Cassetti

A

,

Radillo

O

,

SPESSOTTOTO

P

,

de Seta

F

,

Гуаскино

S

,

Тедеско

F

.

VE-кадгерин является важной молекулой для взаимодействия трофобласта с эндотелиальными клетками в децидуальных спиральных артериях

.

Exp Cell Res

2005

;

303

:

101

113

.11.

ZHOU

Y

,

DAMSKY

CH

,

CHIU

K

,

K

,

Roberts

JM

,

Fisher

SJ

.

Преэклампсия связана с аномальной экспрессией молекул адгезии инвазивными цитотрофобластами

.

Дж. Клин Инвест

1993

;

91

:

950

960

.12.

Caniggia

I

,

Winter

J

,

Щелок

SJ

,

Post

M

.

Кислород и развитие плаценты в первом триместре: значение для патофизиологии преэклампсии

.

Плацента

2000

;

21

(доп. А):

S25

S30

.13.

Каруманчи

SA

,

Бдолах

Y

.

Гипоксия и sFlt-1 при преэклампсии: вопрос «курицы и яйца»

.

Эндокринология

2004

;

145

:

4835

4837

.14.

Боржиховски

AM

,

Сарджент

IL

,

Редман

CW

.

Воспаление и преэклампсия

.

Semin Fetal Neonatal Med

2006

;

11

:

309

316

.15.

Гэммилл

HS

,

Робертс

JM

.

Новые концепции в исследовании преэклампсии

.

Front Biosci

2007

;

12

:

2403

2411

.16.

Сибай

Б

,

Деккер

Г

,

Купферминц

М

.

Преэклампсия

.

Ланцет

2005

;

365

:

785

799

.17.

Вестермарк

J

,

Кахари

ВМ

.

Регуляция экспрессии матриксной металлопротеиназы при опухолевой инвазии

.

FASEB J

1999

;

13

:

781

792

.18.

Коэн

М

,

Мейссер

А

,

Бишоф

Р

.

Металлопротеиназы и инвазивность плаценты человека

.

Плацента

2006

;

27

:

783

793

.19.

Нагасе

H

,

Виссе

R

,

Мерфи

G

.

Структура и функция матриксных металлопротеиназ и ТИМП

.

Cardiovasc Res

2006

;

69

:

562

573

.20.

Lockwood

CJ

,

Krikun

G

,

G

,

Hausknecht

VA

,

PAPP

C

,

Schatz

F

.

Экспрессия матриксной металлопротеиназы и ингибитора матриксной металлопротеиназы в стромальных клетках эндометрия во время инициированной прогестином децидуализации и связанной с менструацией отмены прогестина

.

Эндокринология

1998

;

139

:

4607

4613

.21.

Чжан

J

,

Саламонсен

ЛА

.

Тканевой ингибитор металлопротеиназ (TIMP)-1, -2 и -3 в эндометрии человека во время менструального цикла

.

Моль Гум Репрод

1997

;

3

:

735

741

.22.

Роджерс

,

wh

,

,

LM

,

,

LC

,

,

,

Cannon

P

,

SVITEK

C

,

Gorstein

F

,

Остин

кг

.

Паттерны экспрессии матриксных металлопротеиназ в циклическом эндометрии предполагают дифференциальные функции и регуляцию стероидными гормонами

.

Дж Клин Инвест

1994

;

94

:

946

953

.23.

Севаль

Й

,

Аккоюнлу

Г

,

Демир

Р

,

Асар

М

.

Характер распределения матричных металлопротеиназ (ММП)-2 и -9 и их ингибиторов (ТИМП-1 и ТИМП-2) в децидуальной оболочке человека на ранних сроках беременности

.

Acta Histochem

2004

;

106

:

353

362

.24.

GOFFIN

FOFFIFIN

F

,

MUNAUT

C

,

C

,

Frankenne

F

,

Perrier D’Hauterive

S

,

Béliard

A

,

FRIDMAN

V

,

V

,

Lerving

P

,

Colige

A

,

Foidart

JM

.

Характер экспрессии металлопротеиназ и тканевых ингибиторов матриксных металлопротеиназ в циклическом эндометрии человека

.

Биол Репрод

2003

;

69

:

976

984

.25.

RINEHART

BK

,

Terrone

,

,

DA

,

,

,

S

,

,

,

,

Hale

EA

,

EA

,

Martin

JN

,

Bennett

WA

.

Экспрессия плацентарных цитокинов фактора некроза опухоли альфа, интерлейкина 1бета и интерлейкина 10 увеличивается при преэклампсии

.

Am J Obstet Gynecol

1999

;

181

:

915

920

.26.

Hefler

LA

,

Tempfer

CB

,

Gregg

AR

.

Полиморфизмы внутри кластера генов интерлейкина-1 бета и преэклампсия

.

Акушерство Гинекол

2001

;

97

:

664

668

.27.

BAUER

S

,

S

,

J

,

J

,

Hartmann

J

,

Husslein

P

,

P

,

APLIN

JD

,

Knofler

M

.

Фактор некроза опухоли-альфа ингибирует миграцию трофобласта за счет повышения уровня ингибитора активатора плазминогена-1 в культурах эксплантатов ворсинок первого триместра

.

J Clin Endocrinol Metab

2004

;

89

:

812

822

.28.

Lockwood

CJ

,

Matta

P

,

P

,

Krikun

G

,

Koopman

La

,

R

,

TOTI

P

,

Arcuri

F

,

Хуан

ST

,

Фунай

EF

,

Шац

F

.

Регуляция экспрессии хемоаттрактантного белка-1 моноцитов с помощью фактора некроза опухоли-альфа и интерлейкина-1бета в децидуальных клетках первого триместра человека: значение для преэклампсии

.

Am J Pathol

2006

;

168

:

445

452

.29.

Abrahams

VM

,

KIM

,

KIM

YM

,

STRASZEWSKI

SL

,

ROMERO

R

,

MOR

G

.

Макрофаги и клиренс апоптотических клеток во время беременности

.

Am J Reprod Immunol

2004

;

51

:

275

282

.30.

Reister

F

,

F

,

Фрэнк

HG

,

,

,

JC

,

Heyl

W

,

Kaufmann

P

,

Rath

W

,

HUPPERTZ

B

.

Индуцированный макрофагами апоптоз ограничивает эндоваскулярную инвазию трофобласта в стенку матки у женщин с преэклампсией

.

Лаб Инвест

2001

;

81

:

1143

1152

.31.

Натан

CF

.

Секреторные продукты макрофагов

.

Дж Клин Инвест

1987

;

79

:

319

326

.32.

Данн

CL

,

Келли

RW

,

Кричли

HO

.

Децидуализация стромальных клеток эндометрия человека: загадочная трансформация

.

Reprod Biomed Online

2003

;

7

:

151

161

.33.

Моффет-Кинг

А

.

Натуральные клетки-киллеры и беременность

.

Nat Rev Immunol

2002

;

2

:

656

663

.34.

Бюллетени комитета ACOG по практике — акушерство.

Диагностика и лечение преэклампсии и эклампсии. Номер 33, январь 2002 г., Американский колледж акушеров и гинекологов

.

Акушерство Гинекол

2002

;

99

:

159

167

.35.

Arici

A

,

Marshburn

PB

,

MacDonald

PC

,

Dombrowski

RA

RA.

Метаболизм прогестерона в клетках стромы и железы эндометрия человека в культуре

.

Стероиды

1999

;

64

:

530

534

.36.

Romanic

AM

,

белый

RF

,

RF

,

ARLETH

AJ

,

OHLSTEIN

EH

,

барон

FC

.

Экспрессия матриксной металлопротеиназы увеличивается после очаговой ишемии головного мозга у крыс: ингибирование матриксной металлопротеиназы-9 уменьшает размер инфаркта

.

Ход

1998

;

29

:

1020

1030

.37.

ZYGMUNT

M

,

M

,

McKinnon

T

,

HERR

F

,

LALA

PK

,

HAN

ВК

.

ХГЧ увеличивает миграцию трофобластов in vitro через инсулиноподобный фактор роста-II/маннозо-6-фосфатный рецептор

.

Моль Гум Репрод

2005

;

11

:

261

267

.38.

IRWIN

JC

,

SUEN

,

,

LF

,

Martina

Na

,

Mark

SP

,

Giudice

LC

.

Роль системы ИФР в инвазии трофобласта и преэклампсии

.

Hum Reprod

1999

;

14

(доп. 2):

90

96

.39.

IRWIN

JC

,

SUEN

LF

,

LF

,

Faessen

GH

,

Popovici

RM

,

Giudice

LC

.

Ингибирование инсулиноподобным фактором роста (IGF)-II ткани стромальных клеток эндометрия ингибитором металлопротеиназы-3 и IGF-связывающего белка-1 предполагает паракринные взаимодействия на границе децидуальной оболочки:трофобласта во время имплантации человека

.

J Clin Endocrinol Metab

2001

;

86

:

2060

2064

.40.

Nicola

C

,

C

,

Timoshenko

AV

,

AV

,

Dixon

SJ

,

LALA

PK

,

Chakraborty

C

.

Опосредованная рецептором EP1 миграция вневорсинчатого трофобласта человека в первом триместре беременности: роль внутриклеточного кальция и кальпаина

.

J Clin Endocrinol Metab

2005

;

90

:

4736

4746

.41.

Caniggia

I

,

I

,

Grisaru-Gravnosky

S

,

S

,

M

,

M

,

Post

M

,

LYE

SJ

.

Ингибирование TGF-бета 3 восстанавливает инвазивную способность вневорсинчатых трофобластов при преэклампсии при беременности

.

Дж. Клин Инвест

1999

;

103

:

1641

1650

.42.

Lysiak

JJ

,

Hunt

J

,

Pringle

GA

,

Lala

PK

.

Локализация трансформирующего фактора роста бета и его естественного ингибитора декорина в плаценте и децидуальной оболочке человека на протяжении всей беременности

.

Плацента

1995

;

16

:

221

2231

.43.

Сюй

Г

,

Гимонд

МДж

,

Чакраборти

С

,

Лала

ПК

.

Контроль пролиферации, миграции и инвазивности вневорсинчатого трофобласта человека с помощью декорина, децидуального продукта

.

Биол Репрод

2002

;

67

:

681

689

.44.

Ferretti

C

,

C

,

Bruni

L

,

Rathles-Marie

V

,

Pecking

AP

,

BELET

D

.

Молекулярные цепи, общие для плацентарных и раковых клеток, и их влияние на пролиферативные, инвазивные и миграционные способности трофобластов

.

Обновление воспроизведения шума

2007

;

13

:

121

141

.45.

DANO

K

,

K

,

N

,

N

,

Goyer-Hansen

G

,

Johnsen

M

,

LUND

LR

,

Ploug

M

,

Romer

J

.

Активация плазминогена и рак

.

Тромб Гемост

2005

;

93

:

676

681

.46.

Бьорклунд

M

,

Койвунен

E

.

Опосредованная желатиназой миграция и инвазия раковых клеток

.

Биохим Биофиз Акта

2005

;

1755

:

37

69

.47.

Альмхольт

К

,

Джонсен

М

.

Вовлечение стромальных клеток при раке

.

Недавние результаты рака Res

2003

;

162

:

31

42

.48.

Pedersen

TX

,

Pennington

CJ

,

,

K

,

Christensen

IJ

,

Nielsen

BS

,

Edwards

DR

,

Romer

J

,

Дано

К

,

Джонсен

М

.

мРНК внеклеточной протеазы преимущественно экспрессируются в стромальных областях микродиссекции карциномы молочной железы мыши

.

Канцерогенез

2005

;

26

:

1233

1240

.49.

Librach

CL

,

WERB

Z

,

,

мл

,

CHIU

K

,

CORWIN

NM

,

ESTEVES

RA

,

Grobelny

D

,

Galardy

R

,

Дамский

CH

,

Fisher

SJ

.

Коллагеназа IV типа 92 кДа опосредует инвазию цитотрофобластов человека

.

J Cell Biol

1991

;

113

:

437

449

.50.

Норвиц

ER

.

Дефектная имплантация и плацентация: разработка плана осложнений беременности

.

Reprod Biomed Online

2006

;

13

:

591

599

.51.

HU

Y

,

Y

,

Dutz

JP

,

Maccalman

CD

,

Йонг

P

,

Tan

R

,

VON D

,

VON DEDELSZEN

P

.

Децидуальные NK-клетки изменяют вневорсинчатую миграцию цитотрофобласта в первом триместре in vitro: роль IFN-gamma

.

J Иммунол

2006

;

177

:

8522

8530

.52. .

Взаимодействие сокультивируемых децидуальных эндотелиальных клеток и цитотрофобластов при преэклампсии

.

Биол Репрод

2004

;

71

:

244

252

.53.

Чжан

Дж

,

Хэмптон

АЛ

,

Ни

Г

,

Саламонсен

ЛА

.

Прогестерон ингибирует активацию латентной матриксной металлопротеиназы (ММР)-2 с помощью ММР мембранного типа 1: ферменты, согласованно экспрессирующиеся в эндометрии человека

.

Биол Репрод

2000

;

62

:

85

94

.54.

TAHABALASINGAM

U

,

U

,

,

JP

,

CHRETIEN

M

,

SEIDAH

NG

,

NG

E

,

GRAF

K

.

Фуриноподобные пропротеинконвертазы являются центральными регуляторами протеолитического каскада мембранного типа матриксная металлопротеиназа-проматриксная металлопротеиназа-2 при атеросклерозе

.

Тираж

2005

;

111

:

2820

2827

.55.

RIGOT

V

,

V

,

Marbaix

E

,

Lemoine

P

,

CURTOY

PJ

,

EECKHOUT

Y

.

In vivo перименструальная активация прожелатиназы B (proMMP-9) в эндометрии человека и ее зависимость от стромелизина 1 (MMP-3) ex vivo

.

Biochem J

2001

;

358

:

275

280

.56.

Мерфи

G

,

Вилленброк

F

.

Тканевые ингибиторы металлоэндопептидаз матрикса

.

Методы Enzymol

1995

;

248

:

496

510

.57.

Nee

L

,

Tuite

N

,

Райан

MP

,

McMorrow

T

.

TNF-альфа и IL-1 бета-опосредованная регуляция MMP-9 и TIMP-1 в клубочковых мезангиальных клетках человека

.

Nephron Exp Nephrol

2007

;

107

:

е73

е86

.58.

Lauder

SN

,

,

SM

,

CE

,

,

RJ

,

Talamas

F

,

Bondeson

J

,

Brennan

P

,

Вильямс

КАК

.

Индуцированная интерлейкином-1бета активация ядерного фактора каппаб может быть ингибирована новыми фармакологическими агентами при остеоартрите

.

Ревматология (Оксфорд

)

2007

;

46

:

752

758

.59.

Гомес

DE

,

Алонсо

DF

,

Йошиджи

H

,

Торгейрссон

UP

8 .

Тканевые ингибиторы металлопротеиназ: структура, регуляция и биологические функции

.

Евро J Cell Biol

1997

;

74

:

111

122

.60.

Schatz

F

,

Papp

C

,

Toth-Pal

E

,

Lockwood

CJ

.

Модулируемая стероидами экспрессия стромелизина-1 яичников в стромальных и децидуальных клетках эндометрия человека

.

J Clin Endocrinol Metab

1994

;

78

:

1467

1472

.61.

Salamonsen

La

,

Butt

AR

,

Hammond

FR

,

GARCIA

S

,

Zhang

J

.

Продукция матриксных металлопротеиназ эндометрия, но не их тканевых ингибиторов, модулируется отменой прогестерона в модели менструации in vitro

.

J Clin Endocrinol Metab

1997

;

82

:

1409

1415

.62.

Singer

CF

,

Marbaix

E

,

E

,

Lemoine

P

,

P

,

PJ

,

Eckhout

y

.

Локальные цитокины индуцируют дифференциальную экспрессию матриксных металлопротеиназ, но не их тканевых ингибиторов в фибробластах эндометрия человека

.

Eur J Biochem

1999

;

259

:

40

45

.63.

Meisser

A

,

Chardonnens

D

,

Campana

A

,

Bischof

P

9.

Влияние фактора некроза опухоли-альфа, интерлейкина-1-альфа, макрофагального колониестимулирующего фактора и трансформирующего фактора роста бета на металлопротеиназы трофобластического матрикса

.

Моль Гум Репрод

1999

;

5

:

252

260

.64.

Кармакар

S

,

Дас

C

.

Регуляция инвазии трофобласта с помощью IL-1beta и TGF-beta1

.

Am J Reprod Immunol

2002

;

48

:

210

219

.65.

Коэн

М

,

Мейссер

А

,

Хенгели

Л

,

Бишоф

Р

.

Участие пути MAPK в индуцированной TNF-альфа экспрессии MMP-9 в клетках трофобласта человека

.

Моль Гум Репрод

2006

;

12

:

225

232

.66.

RENAUD

SJ

,

Postovit

LM

,

LM

,

MacDonald-GoodFellow

SK

,

McDonald

GT

,

Caldwell

JD

,

GRAHAM

CH

.

Активированные макрофаги ингибируют инвазивность цитотрофобласта человека in vitro

.

Биол Репрод

.

2005

;

73

:

237

243

.67.

Рено

SJ

,

Макдональд-Гудфеллоу

SK

,

Грэм

CH

.

Координированная регуляция инвазивности трофобласта человека макрофагами и интерлейкином 10

.

Биол Репрод

2007

;

76

:

448

454

.

Примечания автора

© 2008 Общество изучения репродукции, Inc.

.

Добавить комментарий

Ваш адрес email не будет опубликован.